ID: 1138010842

View in Genome Browser
Species Human (GRCh38)
Location 16:53378417-53378439
Sequence AAAACAAGGGCTTAGGTAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138010837_1138010842 0 Left 1138010837 16:53378394-53378416 CCTTTTAAGGTAGGTCAGTGGGG No data
Right 1138010842 16:53378417-53378439 AAAACAAGGGCTTAGGTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138010842 Original CRISPR AAAACAAGGGCTTAGGTAAC AGG Intergenic