ID: 1138011679

View in Genome Browser
Species Human (GRCh38)
Location 16:53386587-53386609
Sequence CCTCCTTAGCTGAAGGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138011667_1138011679 18 Left 1138011667 16:53386546-53386568 CCTGGGTGGTGGGGTGAGCATGG No data
Right 1138011679 16:53386587-53386609 CCTCCTTAGCTGAAGGTGGTGGG No data
1138011666_1138011679 19 Left 1138011666 16:53386545-53386567 CCCTGGGTGGTGGGGTGAGCATG No data
Right 1138011679 16:53386587-53386609 CCTCCTTAGCTGAAGGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138011679 Original CRISPR CCTCCTTAGCTGAAGGTGGT GGG Intergenic
No off target data available for this crispr