ID: 1138011679 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:53386587-53386609 |
Sequence | CCTCCTTAGCTGAAGGTGGT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1138011667_1138011679 | 18 | Left | 1138011667 | 16:53386546-53386568 | CCTGGGTGGTGGGGTGAGCATGG | No data | ||
Right | 1138011679 | 16:53386587-53386609 | CCTCCTTAGCTGAAGGTGGTGGG | No data | ||||
1138011666_1138011679 | 19 | Left | 1138011666 | 16:53386545-53386567 | CCCTGGGTGGTGGGGTGAGCATG | No data | ||
Right | 1138011679 | 16:53386587-53386609 | CCTCCTTAGCTGAAGGTGGTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1138011679 | Original CRISPR | CCTCCTTAGCTGAAGGTGGT GGG | Intergenic | ||
No off target data available for this crispr |