ID: 1138014416

View in Genome Browser
Species Human (GRCh38)
Location 16:53415740-53415762
Sequence CTGGAAAACGGTTGCTCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138014416_1138014420 -2 Left 1138014416 16:53415740-53415762 CCCTTGGAGCAACCGTTTTCCAG No data
Right 1138014420 16:53415761-53415783 AGCCTCCTCATCATTCCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138014416 Original CRISPR CTGGAAAACGGTTGCTCCAA GGG (reversed) Intergenic
No off target data available for this crispr