ID: 1138016783

View in Genome Browser
Species Human (GRCh38)
Location 16:53435188-53435210
Sequence GAGACCCAGGTGCCACAACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 209}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138016783 Original CRISPR GAGACCCAGGTGCCACAACC CGG (reversed) Intronic
900485903 1:2922662-2922684 GAGACTCAGGAGCCAGAGCCCGG + Intergenic
900970351 1:5989199-5989221 GAGCCCCAGGAGCCACCACAGGG + Intronic
901610592 1:10494827-10494849 GAGAACCAGATTCCACCACCAGG - Intronic
904707279 1:32400991-32401013 GACACCCAGGTGCCACCAGATGG + Intergenic
905062311 1:35150218-35150240 GACAGCCGGGTGCCACACCCTGG - Intergenic
906962342 1:50426211-50426233 TAGACCCTGCTGCCTCAACCTGG - Intergenic
908492052 1:64654877-64654899 CAGACCCAAGTGCCACCCCCTGG - Intronic
908838736 1:68256655-68256677 GACAGCCTGGTGCCACACCCTGG + Intergenic
910852530 1:91662790-91662812 GACAGCCTGGTGCCACACCCTGG - Intergenic
915660202 1:157399288-157399310 GACAGCCTGGTGCCACACCCTGG - Intergenic
919378187 1:196819556-196819578 GAGACTCAGGGACCACAACAAGG + Intergenic
919387882 1:196943592-196943614 GAGACTCAGGGACCACAACAAGG + Intronic
920258065 1:204669949-204669971 GAGACCCAGTTACCAAAGCCAGG + Intronic
920309608 1:205041297-205041319 GAGACCCAGCTCCCACCACAGGG + Intergenic
921074276 1:211687154-211687176 GACAGCCCGGTGCCACACCCTGG + Intergenic
923228777 1:231964015-231964037 GACAGCCCGGTGCCACACCCTGG - Intronic
923260024 1:232259523-232259545 AAGTCCCAGGTGCCACAAAAGGG - Intergenic
923557479 1:235012287-235012309 GAGAGCCAGGTGGAACAACCTGG + Intergenic
923970671 1:239199991-239200013 GACAGCCTGGTGCCACACCCTGG + Intergenic
924779417 1:247132652-247132674 GACAGCCCGGTGCCACACCCTGG + Intronic
1064302614 10:14136145-14136167 GAAACTCAGGTGCCACCACTGGG + Intronic
1064315399 10:14250809-14250831 GAGGCCCAGGAGTCACAGCCAGG + Intronic
1068189895 10:53637635-53637657 GACAGCCCGGTGCCACACCCTGG - Intergenic
1068671353 10:59726801-59726823 GACAGCCCGGTGCCACACCCTGG - Intronic
1069536894 10:69260366-69260388 GACACTCAGGTGCCCCAACTTGG - Intronic
1069713603 10:70506749-70506771 GAGACCCAGGGGTCTCAATCAGG + Intronic
1069854591 10:71432923-71432945 GAGTCCCAGGTGCAAACACCAGG - Intronic
1070039300 10:72759425-72759447 GACAGCCTGGTGCCACACCCTGG - Intronic
1070482319 10:76894991-76895013 GATAGCCCGGTGCCACACCCTGG + Intronic
1071611343 10:87034220-87034242 GACAGCCTGGTGCCACACCCTGG + Intergenic
1072798514 10:98375147-98375169 CAGATCCAGGTTCCACAGCCAGG + Intergenic
1073287538 10:102397765-102397787 CAGACCCAGGTTTCAGAACCTGG + Intronic
1073443090 10:103564363-103564385 GAGAGCCACGTGGCACAACTGGG + Intronic
1074854265 10:117461868-117461890 GACACCCAGGTCCTACATCCAGG + Intergenic
1077126841 11:943458-943480 GACAGCCCGGTGCCACACCCTGG - Intronic
1077259864 11:1610782-1610804 GACAGCCCGGTGCCACACCCTGG - Intergenic
1077391117 11:2301063-2301085 GAGAACCAGGAGGGACAACCAGG - Intronic
1079744194 11:24104739-24104761 GTTACCCTGATGCCACAACCAGG + Intergenic
1082767103 11:57179135-57179157 GAGCCCCAGGTGCCCCCACCTGG + Intergenic
1083184966 11:61012303-61012325 GAGATCCAGGGACCACACCCCGG + Intronic
1083614197 11:64018360-64018382 GAGGCCCAGGGGCCAGAACGGGG - Intronic
1083656104 11:64230536-64230558 GAGAAGGAGGGGCCACAACCAGG - Exonic
1083899083 11:65635075-65635097 GAACCCCAGGCGCCACAACGCGG - Exonic
1084614561 11:70226938-70226960 GACACCCAGGTCCCTCTACCAGG + Intergenic
1087394799 11:97583951-97583973 GACAGCCCGGTGCCACACCCTGG - Intergenic
1088120063 11:106358392-106358414 GAGACCCAGGTCCTAGGACCAGG - Intergenic
1088976595 11:114821787-114821809 GAGGCCCAGCTGCCTCAACCTGG + Intergenic
1092390465 12:8073094-8073116 GACAGCCTGGTGCCACACCCTGG + Intergenic
1097177125 12:57149703-57149725 GAGAACGAGGTGACACAACACGG + Intronic
1097912959 12:64990326-64990348 GACAGCCCGGTGCCACACCCTGG + Intergenic
1098749095 12:74272678-74272700 GAGAGCCCGGCGCCACACCCTGG + Intergenic
1099483705 12:83200948-83200970 GACAGCCCGGTGCCACACCCTGG + Intergenic
1100400553 12:94225639-94225661 TAGCCCCAGGTCCCACAACTTGG + Intronic
1101029959 12:100648510-100648532 GACAGCCTGGTGCCACACCCTGG - Intergenic
1101038856 12:100733595-100733617 GAGAGCCAGGTGCCAGACCCTGG - Intronic
1101687929 12:107044112-107044134 AAGACCCAGTTGCCAAAACAGGG + Intronic
1103716699 12:122949418-122949440 GAGGGCCAGGGGCCACAACGGGG - Intronic
1104820918 12:131677199-131677221 GTGACCCAGCTCCCACAAGCTGG - Intergenic
1104928910 12:132328291-132328313 GGCTCCCAGGTGCCACAACTTGG + Intronic
1105546123 13:21352249-21352271 AAGACCCAGGGGCCAGAGCCAGG + Intergenic
1106340157 13:28819937-28819959 GAGACCCAGGCGCCTCCTCCCGG - Intergenic
1113737251 13:112687890-112687912 GAGTCCTTGGTGGCACAACCAGG - Intergenic
1113975382 13:114224334-114224356 GAGACCCAGAATCCACATCCAGG - Intergenic
1115491600 14:33963586-33963608 GACAGCCCGGTGCCACACCCTGG - Intronic
1120873637 14:89359857-89359879 GAGGCCCAGCTGCCCCAGCCAGG - Intronic
1122217029 14:100211547-100211569 CAGCCCCAGGTGCCTCAGCCTGG + Intergenic
1122347126 14:101067514-101067536 GAGACCCAAGTGCCACAGGCTGG - Intergenic
1122549732 14:102543518-102543540 GTGTCCCAGGTGCCCCACCCGGG + Intergenic
1126675245 15:51155197-51155219 GAGATCCAGGTGCACCAGCCAGG + Intergenic
1127308608 15:57731400-57731422 GTCACCCAGCTGTCACAACCAGG + Intronic
1128289412 15:66465525-66465547 GACAGCCTGGTGCCACACCCTGG - Intronic
1130649788 15:85756044-85756066 GAGCGCCAGGTGCCAAACCCAGG + Intergenic
1133797246 16:9056209-9056231 GAGACCCTGGGGCCAAATCCTGG + Intergenic
1136455027 16:30375617-30375639 GAGACCCAGGAGCCACAGACGGG + Intronic
1137281312 16:46979063-46979085 GAGACACAGGTGAAACAACCTGG + Intergenic
1137716537 16:50601721-50601743 CAGAGCCAGGAGCCACCACCAGG + Intronic
1138016783 16:53435188-53435210 GAGACCCAGGTGCCACAACCCGG - Intronic
1139961498 16:70720702-70720724 GAGACACAAGTGCCACAATCAGG + Intronic
1140032315 16:71348561-71348583 GAGACCCAGGTGTCACTAACTGG + Intergenic
1142361898 16:89631248-89631270 GTGACCCAGGTGCCCCAGCGAGG - Intronic
1142761350 17:2043620-2043642 GAGGCCTAGGTGGCACAATCAGG + Intergenic
1143661513 17:8327237-8327259 GAGAACCAGGAGACACAGCCAGG - Intergenic
1143680187 17:8470507-8470529 GAGACCCAGGAGCCAAAGCTGGG + Intronic
1143908986 17:10231961-10231983 AAGATCCAGGAGCCAGAACCAGG - Intergenic
1148587285 17:48790164-48790186 GAGGCCGAGGTGCCACCTCCAGG + Intronic
1148751034 17:49946084-49946106 GAGACCCAGGTGCTAGAGCTGGG - Intergenic
1150577920 17:66446337-66446359 AAGGCCCATGTCCCACAACCAGG - Intronic
1152335346 17:79697436-79697458 GAGACCCAGGTGCTTCCCCCTGG + Intergenic
1152544377 17:80993368-80993390 GAGACCCAGGGGCCAAAGGCAGG - Intronic
1152621277 17:81366115-81366137 GTGTGCCAGGTGCCACAGCCAGG + Intergenic
1152735062 17:81993133-81993155 AAGCCCAAGGTGCCACACCCAGG - Intronic
1152848843 17:82619421-82619443 GAGACCCAGGAGGAACACCCAGG + Intronic
1153852945 18:9113633-9113655 GATAGCCCGGTGCCACACCCTGG + Intronic
1154017131 18:10628533-10628555 GTGACACAGTTGCCACCACCAGG - Intergenic
1154187728 18:12201070-12201092 GTGACACAGTTGCCACCACCAGG + Intergenic
1154325432 18:13387528-13387550 GCCGCCCAGGTGCCACACCCAGG + Exonic
1155412445 18:25561624-25561646 GATTCCCAGGTGCTAAAACCAGG + Intergenic
1157130369 18:45001750-45001772 CATACCAAGATGCCACAACCAGG + Intronic
1157442286 18:47720103-47720125 GAGACCCACTTGCCCCAACATGG + Intergenic
1160237776 18:77099574-77099596 GAGCCCCAGGTGGCACAGCCGGG - Intronic
1160710492 19:548981-549003 GAGTCCCTGCTGCCACCACCTGG - Exonic
1161446961 19:4323867-4323889 GAGGTCCCGGTGCCACACCCAGG - Intergenic
1161479091 19:4501796-4501818 GAGCCTCAGGTGCCACAACGGGG + Intronic
1163103121 19:15109343-15109365 GAGCCCCCGGGGCCACAGCCTGG + Exonic
1163836423 19:19577497-19577519 GAGACACAGGTGACACCACAGGG - Intronic
1164804636 19:31107392-31107414 GGGGCACAGGTGCCACAATCTGG + Intergenic
1164943609 19:32270900-32270922 GAGCCCCAGGCGGCAAAACCAGG + Intergenic
1165983704 19:39748602-39748624 GACACCCAGGTACCACATCGAGG + Intergenic
1166781744 19:45346766-45346788 GAGAGCCAGGTGCCACGGGCAGG + Exonic
925415349 2:3666462-3666484 GAGACCCACAGGCCACAGCCAGG + Intronic
925428715 2:3772770-3772792 GAGACCCAGGTGACAGAAGCTGG - Intronic
925591765 2:5516954-5516976 GGGAGCCAGGAGCCACAACTAGG + Intergenic
925999610 2:9319604-9319626 AAGGCCCAAGTGCCACAGCCTGG - Intronic
928021910 2:27712105-27712127 GGGACCCCGGTGCTACAACCTGG - Intronic
935128313 2:100242919-100242941 GAAACCCAGATGCCAAGACCTGG + Intergenic
935515076 2:104026619-104026641 GAGACCAAAGTGCCACAAAAGGG - Intergenic
937290936 2:120781320-120781342 CAAACCCAGGGGCCAAAACCAGG + Intronic
938262112 2:129903665-129903687 AAAGCCCAGGTGCCACAAGCTGG + Intergenic
939809502 2:146813628-146813650 GACAGCCCGGTGCCACATCCTGG + Intergenic
942286405 2:174421761-174421783 GAGAAGCAGATGCCACAACATGG - Intronic
943551179 2:189340811-189340833 CAGACCCAGGAGTCAAAACCTGG + Intergenic
945237170 2:207641960-207641982 GAATCCCAGGGGCCACAGCCTGG - Intergenic
945700239 2:213160617-213160639 GAGAACAAGGTGCCAGAATCCGG + Intergenic
947046821 2:225996480-225996502 GAGACCCTGTTGACAGAACCTGG + Intergenic
947103107 2:226642573-226642595 GATACCCATCTGCCAGAACCAGG + Intergenic
948145184 2:235703369-235703391 GTTGCCCAGGTGCCACAGCCGGG - Intronic
948627316 2:239277040-239277062 GAGTCCCAGGTGCCACCAGCAGG - Intronic
1172020433 20:31909960-31909982 GAGTCCCAGGTGCCATAGCAGGG + Intronic
1173580401 20:44142940-44142962 CAGTCCCAGGTGCCAGCACCTGG - Intronic
1175384590 20:58586186-58586208 GAGACCCAGGTGCTGGAGCCTGG - Intergenic
1176096009 20:63344927-63344949 GAGACCCCCGTGCCAAATCCTGG - Exonic
1176310474 21:5146407-5146429 CTGGCCCAGCTGCCACAACCCGG + Intronic
1176414004 21:6464473-6464495 GAGTCCCAGGTGCCTCATCGTGG - Intergenic
1179306863 21:40162140-40162162 GAAACCCAGGAGGCAGAACCAGG + Intronic
1179689502 21:43072795-43072817 GAGTCCCAGGTGCCTCATCGTGG - Intronic
1179846581 21:44115628-44115650 CTGGCCCAGCTGCCACAACCCGG - Intronic
1179933108 21:44584638-44584660 GAGACCCTGATGCCAAAACCAGG - Intronic
1180594307 22:16963428-16963450 GAGACCCAGGACCGGCAACCTGG - Intronic
1183678397 22:39312620-39312642 GAGACCCAGCTGCCTCACCCTGG + Intergenic
1184242098 22:43216756-43216778 GAGTCCCAGCTTCCCCAACCTGG + Intronic
1184877308 22:47283876-47283898 GTGACCCAGGTACCCCAGCCAGG + Intergenic
1184988997 22:48154796-48154818 GAGACCCAGCTGTCATAGCCAGG - Intergenic
950103629 3:10374638-10374660 GAGACCCGGGTGTGAGAACCTGG + Intronic
951166683 3:19490581-19490603 GACAACCCGGTGCCACACCCTGG - Intronic
954211216 3:49098509-49098531 TAGACCCGGGAACCACAACCAGG + Intronic
954806636 3:53224518-53224540 GAGACCCAGGTTCCAATCCCAGG + Intergenic
955380590 3:58434911-58434933 GACAGCCTGGTGCCACACCCTGG - Intergenic
956585419 3:70859627-70859649 GACAGCCCGGTGCCACACCCTGG + Intergenic
957225552 3:77440825-77440847 GAGACTGAGCTTCCACAACCAGG - Intronic
963491927 3:146012614-146012636 GACAGCCTGGTGCCACACCCTGG - Intergenic
968901840 4:3435683-3435705 GAGGACCACGTGTCACAACCAGG - Intronic
969128266 4:4970336-4970358 AAGACCCATGCTCCACAACCAGG + Intergenic
969435866 4:7189049-7189071 GGGACCCATGTGCCACTCCCAGG - Intergenic
970379692 4:15494309-15494331 GAGACGCATGTGCCAGAGCCGGG + Intronic
972421717 4:38893810-38893832 GTGAACCAGGTGACAAAACCCGG - Intronic
972662353 4:41128784-41128806 GAGATACAGGTGCCCCAACCAGG - Intronic
972902383 4:43700726-43700748 GATACCCAGGTGCTACATCAAGG - Intergenic
972990778 4:44820656-44820678 GACAGCCCGGTGCCACACCCTGG - Intergenic
974447684 4:62007595-62007617 GTGAGCCAGGAGCCACATCCTGG - Intronic
975431037 4:74291158-74291180 CAGACGCACGTGCCACACCCAGG + Intronic
985480870 5:109473-109495 CACCCCCAGGTGCCACACCCTGG + Intergenic
985986580 5:3521436-3521458 AAGGCCCAGCTGCCACCACCTGG - Intergenic
991667822 5:69016943-69016965 AAGTCCCAGGTGACACCACCAGG + Intergenic
993964606 5:94346058-94346080 GACAGCCCGGTGCCACACCCTGG - Intronic
994831920 5:104794621-104794643 GACAGCCTGGCGCCACAACCTGG + Intergenic
995474280 5:112532291-112532313 GACAACCCGGTGCCACACCCTGG + Intergenic
1000236462 5:159366288-159366310 GACAGCCTGGTGCCACATCCTGG + Intergenic
1000628911 5:163569750-163569772 AAGACCCACATGCTACAACCAGG - Intergenic
1002998677 6:2310750-2310772 GACAGCCTGGTGCCACACCCTGG - Intergenic
1004120197 6:12814078-12814100 GACACCCAGGAGCTAAAACCAGG - Intronic
1004361651 6:14976508-14976530 GACAGCCCGGTGCCACACCCTGG - Intergenic
1006375524 6:33669812-33669834 GAGAGCCAGGGCCCACACCCAGG + Intronic
1007787691 6:44290692-44290714 GACACCCATGGGCCACACCCAGG + Intronic
1014434345 6:121405094-121405116 GATAGCCCGGTGCCACACCCTGG - Intergenic
1015021402 6:128480192-128480214 GAAACCCAGGAGCCATCACCAGG + Intronic
1017590217 6:155971167-155971189 GAGAAACAGGTGCCACAAGGAGG + Intergenic
1020044255 7:5028597-5028619 GACAGCCTGGTGCCACACCCTGG - Intronic
1020119491 7:5495177-5495199 GAGACCCAGGTGCCCCCTCAGGG - Intronic
1020166212 7:5809465-5809487 GAGACCCATCTGGCACAACATGG - Intergenic
1020255058 7:6498259-6498281 GAGACCCTGGGGGCACAAGCGGG - Intronic
1022489752 7:30807626-30807648 GACAGCCTGGTGCCACACCCTGG + Intronic
1023472905 7:40544268-40544290 GAGACACAGGGGCCAGAGCCTGG - Intronic
1024718973 7:52113377-52113399 GACAGCCCGGTGCCACACCCTGG + Intergenic
1024772227 7:52736671-52736693 GGGACCCAGGTGCTACCACGTGG + Intergenic
1027400213 7:77798871-77798893 GAGCCCAAGGAGCCACAACGAGG - Exonic
1028215384 7:88125906-88125928 GAACCCAAGGTGCCACAAGCAGG - Intronic
1029252395 7:99246277-99246299 CAAACCCAGCTGCCACAAGCAGG + Intergenic
1029600993 7:101563423-101563445 GGGACCCAGGTGACAGCACCAGG - Intergenic
1030626856 7:111854212-111854234 GACAGCCTGGTGCCACACCCTGG + Intronic
1030757934 7:113312408-113312430 GTGATCCAGGTTCCACAACGTGG + Intergenic
1031882970 7:127217638-127217660 GAGACCTACGAGCCACATCCTGG - Intronic
1033004914 7:137551216-137551238 GAGACCCAGATGCCAAAAGCTGG + Intronic
1034545297 7:151785227-151785249 GAGACACAGGGGCCACAGCCAGG - Intronic
1035026207 7:155828038-155828060 GAGACCCAGGTGCAACAATATGG - Intergenic
1035085650 7:156255130-156255152 GAGGCCCAGGACCCACACCCGGG - Intergenic
1035297820 7:157877009-157877031 GAAACCCTGGTGCCACACTCAGG - Intronic
1036756838 8:11476742-11476764 GAAACCCAGGTGCAAACACCTGG - Intergenic
1037143901 8:15550177-15550199 GACAGCCCGGTGCCACACCCTGG - Intronic
1039671233 8:39601307-39601329 GAGAGCAAAGTGCCACCACCTGG - Intronic
1040744016 8:50617874-50617896 GACAGCCCGGTGCCACACCCTGG - Intronic
1041380288 8:57247863-57247885 AAGGCCCAAGTGCCACAGCCTGG + Intergenic
1044609128 8:94074611-94074633 GATAGCCAGGTGACACAGCCAGG - Intergenic
1045245063 8:100435454-100435476 GTGACCCTGGAGCCACACCCTGG - Intergenic
1048620240 8:136124561-136124583 AAGACCCGGGTGCCAGAAACCGG - Intergenic
1048732717 8:137461571-137461593 GACAGCCAGGCGCCACACCCTGG - Intergenic
1050374673 9:4958389-4958411 AAGACCCAGGTGCCACAGTGGGG + Intergenic
1053312018 9:37026336-37026358 GATTCCCAGGTGCCTCAGCCCGG + Intronic
1056656441 9:88513450-88513472 GACAGCCTGGTGCCACACCCTGG - Intergenic
1057194972 9:93111744-93111766 TAGCCTCAGGTGCCACAGCCTGG + Intronic
1058479209 9:105373669-105373691 GAGAACCAGGTACTTCAACCTGG - Intronic
1060237100 9:121872172-121872194 GACACCCAGATGGCCCAACCTGG - Intronic
1060792398 9:126495313-126495335 GACACCCAGGTGCCACAGGGAGG + Intronic
1060983497 9:127807079-127807101 GAGACCAAGGTGCCGCATGCAGG + Exonic
1186020321 X:5247276-5247298 GACAGCCTGGTGCCACACCCTGG + Intergenic
1186116057 X:6306386-6306408 GAAAGACAGGTGCCAAAACCGGG + Intergenic
1187308468 X:18118631-18118653 GAGACCCAGGTGTTAGAAGCAGG - Intergenic
1188040574 X:25366543-25366565 GATACCCAGGTACCACATCGAGG - Intergenic
1189082213 X:37986516-37986538 GACAGCCCGGTGCCACACCCTGG - Intronic
1189464099 X:41265010-41265032 GAAGCACAGGTGACACAACCTGG + Intergenic
1190798967 X:53771033-53771055 GACAGCCCGGTGCCACACCCTGG + Intergenic
1191967538 X:66776588-66776610 GATACCCAGGTCCTACATCCAGG - Intergenic
1193488338 X:82115550-82115572 GATACTCAGGTGCTACATCCAGG - Intergenic
1195336345 X:103858612-103858634 GACAGCCCGGTGCCACACCCTGG + Intergenic
1196279157 X:113802523-113802545 GAAACCCTGGTGCCACTACTAGG - Intergenic
1196459616 X:115916784-115916806 GACAGCCCGGTGCCACACCCTGG - Intergenic
1196984555 X:121253950-121253972 GATACCCAGGTACTACAGCCAGG - Intergenic
1197728233 X:129790642-129790664 AAGACCACGGTGGCACAACCTGG - Intronic
1200687129 Y:6266857-6266879 GAGGCCCAGAAGCCACAGCCTGG + Intergenic
1201048147 Y:9907853-9907875 GAGGCCCAGAAGCCACAGCCTGG - Intergenic
1201259713 Y:12147035-12147057 GACAGCCTGGTGCCACACCCTGG - Intergenic