ID: 1138022497

View in Genome Browser
Species Human (GRCh38)
Location 16:53497281-53497303
Sequence GCTTCTTGCACTCCACAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 101}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138022487_1138022497 29 Left 1138022487 16:53497229-53497251 CCGTGTGTGCCAGGCACCACAGG 0: 1
1: 2
2: 3
3: 52
4: 472
Right 1138022497 16:53497281-53497303 GCTTCTTGCACTCCACAACCAGG 0: 1
1: 0
2: 2
3: 10
4: 101
1138022491_1138022497 13 Left 1138022491 16:53497245-53497267 CCACAGGGTCGCTGCCAGCACTC 0: 1
1: 0
2: 2
3: 6
4: 194
Right 1138022497 16:53497281-53497303 GCTTCTTGCACTCCACAACCAGG 0: 1
1: 0
2: 2
3: 10
4: 101
1138022492_1138022497 -1 Left 1138022492 16:53497259-53497281 CCAGCACTCCGCACCCTGCTTGG 0: 1
1: 0
2: 0
3: 29
4: 267
Right 1138022497 16:53497281-53497303 GCTTCTTGCACTCCACAACCAGG 0: 1
1: 0
2: 2
3: 10
4: 101
1138022486_1138022497 30 Left 1138022486 16:53497228-53497250 CCCGTGTGTGCCAGGCACCACAG 0: 1
1: 1
2: 7
3: 39
4: 315
Right 1138022497 16:53497281-53497303 GCTTCTTGCACTCCACAACCAGG 0: 1
1: 0
2: 2
3: 10
4: 101
1138022494_1138022497 -9 Left 1138022494 16:53497267-53497289 CCGCACCCTGCTTGGCTTCTTGC 0: 1
1: 0
2: 2
3: 58
4: 736
Right 1138022497 16:53497281-53497303 GCTTCTTGCACTCCACAACCAGG 0: 1
1: 0
2: 2
3: 10
4: 101
1138022490_1138022497 20 Left 1138022490 16:53497238-53497260 CCAGGCACCACAGGGTCGCTGCC 0: 1
1: 0
2: 0
3: 12
4: 177
Right 1138022497 16:53497281-53497303 GCTTCTTGCACTCCACAACCAGG 0: 1
1: 0
2: 2
3: 10
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138022497 Original CRISPR GCTTCTTGCACTCCACAACC AGG Intronic
902264446 1:15251964-15251986 GTCTCTTGTACACCACAACCTGG + Intronic
905213416 1:36390142-36390164 GTTTCTTGCACACCAGAAACTGG + Intergenic
907312707 1:53548183-53548205 GGCTCTGGCACTCCACATCCAGG + Intronic
907871058 1:58443236-58443258 GCTTCTTCCAGTCCACAACTTGG + Intronic
909684254 1:78328845-78328867 GAATCTTGTTCTCCACAACCTGG + Intronic
911052953 1:93687252-93687274 ACTTCTTCAAGTCCACAACCAGG + Intronic
923242509 1:232099414-232099436 CCATCTTTCACTCCAAAACCCGG + Intergenic
924325477 1:242890619-242890641 GCTTCTTGCAAGCCGCCACCCGG + Intergenic
1073905387 10:108274114-108274136 GCTTCTGTCACTCCACCTCCAGG - Intergenic
1079272171 11:18999194-18999216 GCTTGTTTCACTCCACCCCCAGG - Intergenic
1080703739 11:34668513-34668535 GAATCTTGCAATCCACATCCAGG - Intergenic
1082846681 11:57731684-57731706 GCTTCTTGGTCTCCACCACTTGG - Intronic
1084175055 11:67418673-67418695 GCTGCTTCCACTCCGCTACCCGG + Intronic
1084204978 11:67585983-67586005 TCTGCTTGCTCCCCACAACCAGG - Intronic
1084641920 11:70431336-70431358 GCTTCCTCCACTCCACAAACAGG - Intronic
1085053984 11:73393612-73393634 GCTTCCTGCACCCAACAGCCCGG - Intronic
1086414540 11:86575677-86575699 GCTTCATGCACGCCTCTACCAGG + Intronic
1086994931 11:93345489-93345511 GTTTCTTTTTCTCCACAACCTGG + Intronic
1089898008 11:121951347-121951369 GCCTCTAGAACTCCACAACGAGG + Intergenic
1090272980 11:125400726-125400748 GCTTCCTGCACTCCACTAACTGG + Intronic
1099121616 12:78696505-78696527 GCTAGTTGGACTCCACAAGCCGG + Intergenic
1100767860 12:97887520-97887542 GGAGCTTGCACTCCAAAACCAGG + Intergenic
1103839986 12:123855166-123855188 GCCTTTTCCACTCCACATCCTGG + Intronic
1105421834 13:20259380-20259402 GATTCTTCAACTCCACATCCAGG + Intergenic
1107322093 13:39200925-39200947 GCTCCTTGCATTCTACAACTAGG - Intergenic
1113044017 13:106134542-106134564 TCTTCTCACACTCCACAAACAGG + Intergenic
1115579842 14:34746898-34746920 GCACCTGCCACTCCACAACCAGG + Intergenic
1115941720 14:38617764-38617786 GCTTCCTCCACTCCACATCCAGG + Intergenic
1116071935 14:40058339-40058361 CCTTCTTGCACTGTAAAACCGGG - Intergenic
1123632874 15:22274262-22274284 GCTTCTTACACTGCACAAGGCGG - Intergenic
1124086935 15:26559828-26559850 GCTTTTTGCAGAACACAACCGGG + Intronic
1129092085 15:73162105-73162127 TCCTCTTCCTCTCCACAACCCGG + Intronic
1130694751 15:86119768-86119790 GCTACTAGGACCCCACAACCAGG - Intergenic
1132152485 15:99472701-99472723 ACTTATTTCCCTCCACAACCTGG + Intergenic
1132739760 16:1405858-1405880 GCTTCTTGCACTCCAGGATCTGG - Intronic
1133955861 16:10443385-10443407 TCTTCTAGCACCCCACAGCCTGG - Intronic
1137504092 16:49035891-49035913 GCTTCTTTCACACCAGAACTAGG + Intergenic
1138022497 16:53497281-53497303 GCTTCTTGCACTCCACAACCAGG + Intronic
1139097292 16:63719759-63719781 GCATCTTGCCCTCCACAACTAGG - Intergenic
1141970187 16:87476505-87476527 GCTTCTTACACTGCACAAGGCGG + Intronic
1141986055 16:87580847-87580869 GCTTCTTCCACTTCACATTCGGG - Intergenic
1143509204 17:7386284-7386306 ACTGCTTTCACTCCACATCCAGG - Intronic
1143967611 17:10767969-10767991 GCTCCTTCCACACCACACCCTGG - Intergenic
1144862674 17:18315330-18315352 GCTCCTAGGACGCCACAACCCGG - Exonic
1148492258 17:48030891-48030913 GCTTCTGGCTCCCCAAAACCTGG + Intronic
1151551753 17:74826424-74826446 GCTTCGTTCACTCCTCACCCCGG - Intronic
1152557325 17:81059934-81059956 CCTTCTTGCAGTCAACCACCAGG - Intronic
1155320642 18:24615614-24615636 GCTTCATGAACTCCACCACTTGG + Intergenic
1162059715 19:8087149-8087171 GGTTCTTGCACTCCATGCCCCGG + Exonic
1162367107 19:10256403-10256425 ACCACTTGCACTCCACAGCCTGG + Intronic
1164457302 19:28419404-28419426 GATGCCTGCACTCCACAATCAGG - Intergenic
1168340528 19:55620826-55620848 GACTCTTTCACTCCACACCCAGG + Exonic
927248905 2:20980902-20980924 GCTTCTGGCACTACACACCCAGG + Intergenic
935411902 2:102772689-102772711 GCTTCTTAATCTCCACAAACAGG + Intronic
935701416 2:105815589-105815611 GCTGCCAGCTCTCCACAACCAGG + Intronic
936159141 2:110070867-110070889 GCCTCCTGCTCTCCAGAACCTGG - Intergenic
936185520 2:110300465-110300487 GCCTCCTGCTCTCCAGAACCTGG + Intergenic
937982383 2:127623198-127623220 GCTTCTTGGACTTGACAGCCTGG - Exonic
939291282 2:140198416-140198438 TCTTCTTGCAATGCAGAACCTGG + Intergenic
944888373 2:204088971-204088993 GCTTCTTGCACTCCAGATTATGG + Intergenic
945356022 2:208840844-208840866 GCTTCTTGCTGAACACAACCAGG + Intronic
948947632 2:241229132-241229154 GCTGATTGCACTCCACAAACAGG + Exonic
1170393791 20:15904105-15904127 TCTTCTTGCTCTCCTCACCCCGG + Intronic
1172914887 20:38436143-38436165 GCTGCTTGCACTCCAGAACATGG - Intergenic
1175161298 20:57009807-57009829 GGTTGTTCCACTCCACACCCAGG + Intergenic
1176260552 20:64177510-64177532 GCCTCTTCCTCTCCACACCCTGG - Intronic
1182557166 22:31135480-31135502 GCTTCCTGAACACCACATCCAGG + Exonic
1183921755 22:41175229-41175251 GCTTCTGTCACCCTACAACCAGG - Intronic
953234148 3:41091515-41091537 TCTTCTTGCCCTCCCCAACTTGG - Intergenic
954933821 3:54308384-54308406 GCTTCTTGAACTCCTTAGCCTGG - Intronic
957608496 3:82435364-82435386 GCTCCTTTTTCTCCACAACCTGG - Intergenic
959272763 3:104234643-104234665 GCTTCTTACGTTCCACAACAGGG - Intergenic
962932815 3:140053223-140053245 GCTTCTGGCTCTTCACACCCTGG + Intronic
964623639 3:158738885-158738907 CCTTCTTACATTCCACAAGCTGG - Intronic
964938671 3:162126989-162127011 GCTTCTTCCATGCCCCAACCTGG + Intergenic
977742321 4:100501588-100501610 GCTTCTTGTATTCCACATACTGG + Intronic
979094028 4:116520979-116521001 GCTTCTTTGACTCCTGAACCAGG - Intergenic
983736432 4:171068261-171068283 GGATCTTGCACTTCACATCCCGG - Intergenic
985906547 5:2842066-2842088 GCTTCTTGCATTGCACAACTTGG - Intergenic
987141928 5:14955202-14955224 GCTTCTCTCACTCCACAAGAAGG - Intergenic
1003057440 6:2834650-2834672 TCTTCTAGCACTACTCAACCTGG - Intronic
1006299938 6:33188460-33188482 GCTTCTTGCAGTCAACAATGAGG + Exonic
1010454093 6:76035117-76035139 GCCCCTAGCACTCCACAAACTGG - Intronic
1016207054 6:141481129-141481151 GCTTCTTGCAAGCCACACTCAGG + Intergenic
1020614187 7:10438117-10438139 GCTTCAGGCACCACACAACCTGG + Intergenic
1024715446 7:52074742-52074764 GCTGGTTGCACTCCTCAGCCAGG - Intergenic
1025148712 7:56527596-56527618 GCTTCTATCACTGCAGAACCAGG - Intergenic
1025640188 7:63359857-63359879 GCTTCTGTCACTGCAGAACCAGG + Intergenic
1025642511 7:63388236-63388258 GCTTCTGTCACTGCAGAACCAGG - Intergenic
1029045255 7:97621220-97621242 CCTTCTTGCACTCCAAAATGAGG + Intergenic
1031837991 7:126702358-126702380 CCTTCTTGTACTCCAGAAACTGG + Intronic
1035230511 7:157463188-157463210 TCGTCTTCCACACCACAACCTGG - Intergenic
1036836102 8:12069279-12069301 GGTTCTTGCAATCCACAGCAGGG - Intronic
1036857944 8:12315849-12315871 GGTTCTTGCAATCCACAGCAGGG - Intergenic
1039942495 8:42103068-42103090 CCTTCTTGCACTGCAAAAACAGG - Intergenic
1047436357 8:124838533-124838555 TTTTCTTGCACTCCACTTCCTGG + Intergenic
1048671560 8:136728964-136728986 GCTTCTTGGGCTCCAAAACTGGG + Intergenic
1053195777 9:36117410-36117432 GCTTCTTGCAGTCCACTCCTAGG + Intronic
1059344798 9:113620857-113620879 GCTTCCTGGACTCCGGAACCTGG + Intergenic
1060579696 9:124734217-124734239 GCTTCTAGCACTCATCAACAAGG + Intronic
1061747942 9:132753699-132753721 GCTTCATGCTCTCCACAGCGGGG - Intronic
1185834847 X:3335882-3335904 GCTTCTTGCAGTGAACAACATGG - Intronic
1187020234 X:15373864-15373886 GCTACTTGGACCCCAAAACCAGG - Intronic
1188890675 X:35607698-35607720 GCTTCAAGCACTACAGAACCTGG - Intergenic
1195821069 X:108946000-108946022 GCTTATGTCACTCCACCACCAGG - Intergenic
1197064060 X:122217742-122217764 GCTTATTGCATTCCAGTACCTGG - Intergenic
1197643993 X:128997665-128997687 GCATCTTGCACTTCACAGCAGGG + Intergenic
1197822220 X:130552878-130552900 GCTTACTGCACTCAACACCCGGG - Intergenic
1199144721 X:144351244-144351266 GCTTGTGGCACTCCACCCCCGGG - Intergenic
1199257140 X:145729797-145729819 GCTTCTTGCCCTCCAATCCCCGG - Intergenic
1200424334 Y:3005155-3005177 TCTTCTTGCACCCCACACACTGG - Intergenic
1201860875 Y:18596151-18596173 GCTTCTTGCCCCCCACAACCTGG + Intergenic
1201872448 Y:18724229-18724251 GCTTCTTGCCCCCCACAACCTGG - Intergenic
1201915906 Y:19181041-19181063 CCTTCCAGCACTCCACAGCCTGG + Intergenic