ID: 1138023347

View in Genome Browser
Species Human (GRCh38)
Location 16:53503582-53503604
Sequence CACCACGGAGACCTTCCCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 102}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138023342_1138023347 9 Left 1138023342 16:53503550-53503572 CCGGGTCACAATTGGCCAGGGCG 0: 1
1: 0
2: 0
3: 6
4: 60
Right 1138023347 16:53503582-53503604 CACCACGGAGACCTTCCCGGAGG 0: 1
1: 0
2: 1
3: 7
4: 102
1138023343_1138023347 -6 Left 1138023343 16:53503565-53503587 CCAGGGCGTCTGCCAGTCACCAC 0: 1
1: 0
2: 0
3: 13
4: 127
Right 1138023347 16:53503582-53503604 CACCACGGAGACCTTCCCGGAGG 0: 1
1: 0
2: 1
3: 7
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138023347 Original CRISPR CACCACGGAGACCTTCCCGG AGG Intronic
900456695 1:2778385-2778407 CACAAGGGAGACCTGCCCTGAGG - Intronic
901235344 1:7664617-7664639 CACCATGGAGACCTCGCAGGCGG + Exonic
901909786 1:12446998-12447020 CATCACCCAGACCTTTCCGGAGG - Intronic
903370092 1:22829737-22829759 CATCACGGAGGGCTTCCTGGAGG + Intronic
903652877 1:24931984-24932006 CTTCTCGGAGACGTTCCCGGAGG - Intronic
905281027 1:36849606-36849628 CACCTCTGAGGCCTTCCAGGAGG + Intronic
915516309 1:156414653-156414675 CACCACGGACAGCTCCCGGGCGG - Exonic
917636934 1:176946050-176946072 CATCACGGAGACCTGTCCAGAGG - Exonic
920037498 1:203075666-203075688 TTCCGCGGAGACCCTCCCGGCGG + Exonic
920500415 1:206481737-206481759 AACCACGGAGGCCTTCCTGAAGG + Intronic
1065845009 10:29736608-29736630 CATCTCCGAGACCTTCCCGGGGG + Intronic
1074296212 10:112191946-112191968 CACCACTGGGACCTTCGCTGCGG - Intronic
1075074454 10:119341531-119341553 CACCAGGGAGGGCTTCCTGGAGG - Intronic
1076885702 10:133261511-133261533 CACCACGGGGACGCTCCCAGGGG + Intergenic
1081658380 11:44873019-44873041 CACCAGGGAGGGCTTCCTGGAGG + Intronic
1084425031 11:69079940-69079962 CACCACTGAGACCCTCCCAGGGG - Intronic
1084608717 11:70187300-70187322 CTCCACGGAGACATTTCTGGTGG - Intronic
1085332734 11:75667410-75667432 CACCACGCAGACCCTCCCCGCGG - Intronic
1089811708 11:121137617-121137639 CACCAATGAGACCTTCTGGGTGG + Exonic
1091001094 11:131911199-131911221 CTCCTCGGCCACCTTCCCGGCGG + Intronic
1096195308 12:49645801-49645823 CCCCACTGAGACCCTCTCGGAGG - Exonic
1096354058 12:50925241-50925263 CAGCAGGGAGAGTTTCCCGGAGG - Exonic
1098503078 12:71217045-71217067 CTCCACGGAGAACTCCACGGGGG + Intronic
1123017738 14:105383385-105383407 CGCCACGGCGATCTTCACGGGGG - Exonic
1123420204 15:20125070-20125092 AACCAAGGACACCTTCCTGGAGG + Intergenic
1123445657 15:20328462-20328484 AACCAAGGACACCTTCCTGGAGG - Intergenic
1123529428 15:21131606-21131628 AACCAAGGACACCTTCCTGGAGG + Intergenic
1124632092 15:31343802-31343824 CTCCAAGGAGACCTTCCCCATGG - Intronic
1127893841 15:63277598-63277620 CACCGCGGAAACCGACCCGGGGG - Exonic
1129270022 15:74414700-74414722 ACCCACAGAGACCTTCCAGGTGG - Exonic
1129695916 15:77740664-77740686 CATCAGGGAGAGCTTCCTGGAGG + Intronic
1129794509 15:78366030-78366052 CACCACCCAGACCCTCCCGTAGG + Intergenic
1130370991 15:83284909-83284931 GACCGCGGAGACCTCGCCGGCGG + Intergenic
1130390297 15:83448298-83448320 CGTCAGGGAGAGCTTCCCGGAGG + Intronic
1132650029 16:1016454-1016476 CTCCACACAGAGCTTCCCGGCGG - Intergenic
1132841572 16:1980704-1980726 CCTCAAGGAGACCTTCCCGGTGG - Exonic
1132927384 16:2438016-2438038 CAGCACAGAGAACTGCCCGGGGG - Intronic
1134070139 16:11255708-11255730 CTCCGCGGAGCTCTTCCCGGCGG + Intronic
1134847599 16:17453574-17453596 GAGCACGGAGACTTCCCCGGAGG - Intronic
1136349395 16:29697143-29697165 CACCACAGATCCCTCCCCGGAGG - Intronic
1136450373 16:30351325-30351347 CACCCCTGAGACCATCCCTGGGG + Exonic
1136721085 16:32320144-32320166 AACCAAGGACACCTTCCTGGAGG + Intergenic
1136839469 16:33526430-33526452 AACCAAGGACACCTTCCTGGAGG + Intergenic
1138023347 16:53503582-53503604 CACCACGGAGACCTTCCCGGAGG + Intronic
1140412606 16:74749908-74749930 CAGCACGGAGACTTTCCCTGGGG - Intronic
1142160362 16:88554426-88554448 CTCCCCGGAGCCCTTCCAGGAGG - Intergenic
1142278128 16:89133581-89133603 CCCCACGCAGCCCTTCCTGGTGG + Intronic
1203005347 16_KI270728v1_random:197626-197648 AACCAAGGACACCTTCCTGGAGG - Intergenic
1203136897 16_KI270728v1_random:1733747-1733769 AACCAAGGACACCTTCCTGGAGG - Intergenic
1203149633 16_KI270728v1_random:1826715-1826737 AACCAAGGACACCTTCCTGGAGG + Intergenic
1143315142 17:6026716-6026738 CACCACTGACACCATCCTGGTGG - Intronic
1143448015 17:7020055-7020077 CACCACGGTGACCAGCCAGGGGG - Intergenic
1148367750 17:47069387-47069409 CACCACACAGAACTTCCCAGAGG - Intergenic
1155307296 18:24490841-24490863 CACCACGTGGACCTTCTGGGTGG - Intergenic
1161219853 19:3113545-3113567 CGCCGCGGAGGCCTTCCCGAAGG - Intronic
1161397304 19:4051678-4051700 CAGCCCGGAGACCTTGCCGTGGG - Intronic
1166103055 19:40582633-40582655 CACCAGGGAAGCCTTCCTGGAGG + Intronic
925367681 2:3322149-3322171 CACCACGGAGGCCCTGCCAGGGG - Intronic
933983519 2:87572633-87572655 CACCACAGAGACTGGCCCGGAGG + Intergenic
936148407 2:109997020-109997042 AACCAAGGACACCTTCCTGGAGG + Intergenic
936196270 2:110374348-110374370 AACCAAGGACACCTTCCTGGAGG - Intergenic
936310330 2:111378161-111378183 CACCACAGAGACTGGCCCGGAGG - Intergenic
937443113 2:121933714-121933736 CACCACTGAGACCATCAAGGTGG + Intergenic
937929362 2:127192602-127192624 CACCACTGTGCCTTTCCCGGGGG + Intronic
938595306 2:132782752-132782774 CCCCAGGGAGCCCTTCCCGGAGG + Exonic
1169422363 20:5470797-5470819 CTCCACGGAGACCCTCCAGAAGG - Intergenic
1172880454 20:38196355-38196377 CATCAAGGAGAGCTTCCCTGAGG + Intergenic
1175888311 20:62304513-62304535 CAGCACGTAGACCCTCCCGCTGG - Exonic
1175993896 20:62804010-62804032 CCCCAGGGTGACCCTCCCGGTGG + Intergenic
1180100153 21:45580099-45580121 AGCCAAGGAGACCTTCCTGGTGG + Intergenic
1180551685 22:16546164-16546186 AACCAAGGACACCTTCCTGGAGG - Intergenic
1181271404 22:21660950-21660972 CACCACGGAGACCATGGTGGTGG - Intronic
1181352322 22:22267759-22267781 AACCAAGGACACCTTCCTGGAGG + Intergenic
1181390527 22:22577260-22577282 CACCACGAAGAATTTCCTGGAGG + Intergenic
949875903 3:8625962-8625984 CACAACTGAGCCCTTCCCGTAGG - Intronic
950664210 3:14485232-14485254 CTCCACGGACATCTTCCCGTGGG - Exonic
951728224 3:25783300-25783322 CACCCCGGAGACCTTTTTGGAGG - Exonic
952744513 3:36764455-36764477 GCCCCCGGAGACGTTCCCGGTGG - Intergenic
960684812 3:120285453-120285475 CTCCTCAGAGACCTTCCCTGGGG + Intergenic
969310711 4:6351715-6351737 CCCCACGGAGATCTTACCGTGGG - Intronic
969369060 4:6719771-6719793 CACCACACAGACATTCCCGTGGG + Intergenic
972562773 4:40243458-40243480 CACCTCCGAGACCTTCCCGGAGG + Exonic
980397840 4:132238753-132238775 CACCACAAAGACCTACCCTGGGG - Intergenic
985649094 5:1099079-1099101 CACCACCGGGACCTGCCCTGAGG - Intronic
992690673 5:79237204-79237226 CTCCTCGGAGACCGTCCCAGAGG - Exonic
992975343 5:82111326-82111348 CACCCAGGAGACCTGCCTGGAGG - Intronic
999203002 5:149829508-149829530 CAGCACGGAGAGTTTCCCTGGGG - Intronic
1001094138 5:168763007-168763029 CACCAAGGAGCACTTCCCCGAGG - Intronic
1001113648 5:168920496-168920518 CACCAGCGAGACCATCACGGCGG + Intronic
1001600582 5:172925744-172925766 CACCCTGGAGGCCTTCCTGGAGG - Intronic
1002200814 5:177527049-177527071 CACCAGGGAGTGCTTCCTGGAGG + Intronic
1003666282 6:8114758-8114780 CACCACAGAAACCTTCTCAGAGG - Intergenic
1005765865 6:29011644-29011666 CGCCACGCAGACCTGCCCCGCGG - Intergenic
1006134384 6:31887016-31887038 CTCCACGGAGCCCTTCTGGGCGG + Exonic
1006656405 6:35597381-35597403 CACCACAGCGGCCTTCCAGGTGG + Exonic
1017194361 6:151684184-151684206 CTCCATGGAGACCTTCCTGATGG - Intronic
1018876875 6:167828010-167828032 CTCCACGGAGCCCTTCCTAGTGG - Intronic
1019810899 7:3164495-3164517 CAGCCCGGAGACCTTTCCAGAGG + Intronic
1024222152 7:47297389-47297411 CACCACAGAGACCTCCCTGAAGG - Intronic
1032108625 7:129056026-129056048 CCCCACGAAGAACTTCCTGGAGG - Intergenic
1037086838 8:14862325-14862347 CAACACAGACACCTTCCCAGTGG + Intronic
1039929878 8:41976158-41976180 CACCAAGGAGACATTCAGGGAGG + Intronic
1049469150 8:142767648-142767670 AACCAAGGAGGCCTTCCTGGAGG - Intronic
1053477983 9:38395895-38395917 CAGCAAGAAGACCTTCCCGACGG + Exonic
1058277988 9:103070863-103070885 CACCAGGGAGGGCTTCCCAGTGG - Intergenic
1060186285 9:121566100-121566122 CACCAGGGAGGCCTTCCCAGAGG + Intergenic
1060548889 9:124476030-124476052 CTCCAGGGTGACCTTCCCTGGGG + Intronic
1062477989 9:136738845-136738867 CATCAGGGAGAGCTTCCTGGGGG - Intronic
1186509603 X:10120927-10120949 CACCCCGGACACCTGCCCTGGGG - Intronic
1192481855 X:71492753-71492775 CGGCACGGAGACTTTCCTGGAGG - Intronic
1198530497 X:137546838-137546860 GGCCACGTAGACCTTCCGGGGGG + Intergenic