ID: 1138032741

View in Genome Browser
Species Human (GRCh38)
Location 16:53573374-53573396
Sequence ACTTCAGGCAGCAAACTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138032741_1138032747 16 Left 1138032741 16:53573374-53573396 CCCCCAAGTTTGCTGCCTGAAGT No data
Right 1138032747 16:53573413-53573435 CATTTTTTTGCATAAGTCTCTGG No data
1138032741_1138032748 17 Left 1138032741 16:53573374-53573396 CCCCCAAGTTTGCTGCCTGAAGT No data
Right 1138032748 16:53573414-53573436 ATTTTTTTGCATAAGTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138032741 Original CRISPR ACTTCAGGCAGCAAACTTGG GGG (reversed) Intergenic
No off target data available for this crispr