ID: 1138032747

View in Genome Browser
Species Human (GRCh38)
Location 16:53573413-53573435
Sequence CATTTTTTTGCATAAGTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138032741_1138032747 16 Left 1138032741 16:53573374-53573396 CCCCCAAGTTTGCTGCCTGAAGT No data
Right 1138032747 16:53573413-53573435 CATTTTTTTGCATAAGTCTCTGG No data
1138032744_1138032747 13 Left 1138032744 16:53573377-53573399 CCAAGTTTGCTGCCTGAAGTCTC No data
Right 1138032747 16:53573413-53573435 CATTTTTTTGCATAAGTCTCTGG No data
1138032742_1138032747 15 Left 1138032742 16:53573375-53573397 CCCCAAGTTTGCTGCCTGAAGTC No data
Right 1138032747 16:53573413-53573435 CATTTTTTTGCATAAGTCTCTGG No data
1138032745_1138032747 1 Left 1138032745 16:53573389-53573411 CCTGAAGTCTCCTGATTCTGAAT No data
Right 1138032747 16:53573413-53573435 CATTTTTTTGCATAAGTCTCTGG No data
1138032746_1138032747 -9 Left 1138032746 16:53573399-53573421 CCTGATTCTGAATACATTTTTTT No data
Right 1138032747 16:53573413-53573435 CATTTTTTTGCATAAGTCTCTGG No data
1138032743_1138032747 14 Left 1138032743 16:53573376-53573398 CCCAAGTTTGCTGCCTGAAGTCT No data
Right 1138032747 16:53573413-53573435 CATTTTTTTGCATAAGTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138032747 Original CRISPR CATTTTTTTGCATAAGTCTC TGG Intergenic