ID: 1138034141

View in Genome Browser
Species Human (GRCh38)
Location 16:53585870-53585892
Sequence CAGGCCCAGATGATTTTTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138034141_1138034147 23 Left 1138034141 16:53585870-53585892 CCCTAAAAAATCATCTGGGCCTG No data
Right 1138034147 16:53585916-53585938 TAATATCTTTCTATCTTCCATGG No data
1138034141_1138034145 -10 Left 1138034141 16:53585870-53585892 CCCTAAAAAATCATCTGGGCCTG No data
Right 1138034145 16:53585883-53585905 TCTGGGCCTGGTGTTTTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138034141 Original CRISPR CAGGCCCAGATGATTTTTTA GGG (reversed) Intergenic
No off target data available for this crispr