ID: 1138035164

View in Genome Browser
Species Human (GRCh38)
Location 16:53596880-53596902
Sequence CTATAAGCGTTATGTGTAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138035164_1138035168 10 Left 1138035164 16:53596880-53596902 CCACTTACACATAACGCTTATAG No data
Right 1138035168 16:53596913-53596935 CCTAGTTATGTTGTAGGAGAGGG No data
1138035164_1138035169 30 Left 1138035164 16:53596880-53596902 CCACTTACACATAACGCTTATAG No data
Right 1138035169 16:53596933-53596955 GGGCTATTTCTTGTCCTATTAGG No data
1138035164_1138035165 4 Left 1138035164 16:53596880-53596902 CCACTTACACATAACGCTTATAG No data
Right 1138035165 16:53596907-53596929 TTGTCTCCTAGTTATGTTGTAGG No data
1138035164_1138035166 9 Left 1138035164 16:53596880-53596902 CCACTTACACATAACGCTTATAG No data
Right 1138035166 16:53596912-53596934 TCCTAGTTATGTTGTAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138035164 Original CRISPR CTATAAGCGTTATGTGTAAG TGG (reversed) Intergenic
No off target data available for this crispr