ID: 1138041223

View in Genome Browser
Species Human (GRCh38)
Location 16:53670216-53670238
Sequence TACCCAAGGAGTGTGGGGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 5, 3: 27, 4: 201}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138041223 Original CRISPR TACCCAAGGAGTGTGGGGAT AGG (reversed) Intronic
900306377 1:2010874-2010896 CAGCCAAGGAGGGTGGGGACAGG - Intergenic
900591466 1:3462110-3462132 AGCCCACGGGGTGTGGGGATCGG + Intronic
900944111 1:5820046-5820068 TACACAAGGTGTGTGGAGACAGG + Intergenic
901768593 1:11519288-11519310 TACCCAGGGAGGGTGGGGCAGGG - Intronic
902094828 1:13934521-13934543 TACCCAAGAAGAGGTGGGATTGG + Intergenic
904767072 1:32858160-32858182 AACCCAAGGAGTGAAGGGACAGG + Exonic
909034940 1:70586296-70586318 TCCCCAAGGAGTTTGGGTCTAGG - Intergenic
910796355 1:91101522-91101544 GGACTAAGGAGTGTGGGGATAGG + Intergenic
911218344 1:95219972-95219994 TACAAAAGGAGAGTGGGGAAGGG - Intronic
912740638 1:112192035-112192057 AACCAAAGGAGGGTGGGGGTGGG + Intergenic
913319825 1:117580361-117580383 AGCCCATGGAGGGTGGGGATTGG - Intergenic
913435771 1:118845896-118845918 TTCCCAGGGACTGTGGGGGTTGG - Intergenic
915233248 1:154461772-154461794 TCCCCAAGGAATTTGGGGCTAGG + Intronic
917471984 1:175333871-175333893 CACACAAGGAATGTGGGGAAAGG + Intronic
917733253 1:177897482-177897504 CAGCCAAGGAGGCTGGGGATCGG + Intergenic
920298463 1:204974271-204974293 TACCATCGCAGTGTGGGGATGGG - Exonic
920589596 1:207204355-207204377 TCCCCAAAGAATGTGGGGAAGGG - Intergenic
920933880 1:210412954-210412976 CAGCCAAGGAGTGTGGTGACGGG + Intronic
923392802 1:233530674-233530696 TTCCCAAGGAGTTTGGGGATAGG - Intergenic
1062826144 10:570380-570402 GACCTAGGGAGTGTGGGGTTGGG - Intronic
1065207839 10:23374103-23374125 TCCCCAAGGAGTTTGGGGATAGG - Intergenic
1065734152 10:28736225-28736247 TCCCCAAGGAGTTTGGGGCTAGG + Intergenic
1067353728 10:45503954-45503976 TTACCAAGGATTGTGGGGATGGG + Intronic
1067495298 10:46756147-46756169 GACCCTAGGAGGGTGGGGACTGG - Intergenic
1067599356 10:47584241-47584263 GACCCTAGGAGGGTGGGGACTGG + Intergenic
1067949016 10:50710827-50710849 GACCCTAGGAGGGTGGGGATTGG + Intergenic
1068681740 10:59827450-59827472 TACACATGGAGTGTGAGGACAGG + Intronic
1069908157 10:71744307-71744329 GACCCTAGGACTGTGGGGGTTGG - Intronic
1070382497 10:75893608-75893630 TGCCCAATGAGTCTGGGGCTGGG - Intronic
1070420946 10:76236589-76236611 TCCCCAAGGAGTTTGGGGCTAGG - Intronic
1070884334 10:79875833-79875855 GACCCTAGGAGGGTGGGGACTGG + Intergenic
1071148694 10:82606983-82607005 TCCCCAAGAGGTTTGGGGATGGG - Intronic
1071650889 10:87392133-87392155 GACCCTAGGAGGGTGGGGACTGG + Intergenic
1073192750 10:101663335-101663357 TACACAAGGAGTGAGGTGAAAGG + Intronic
1074769854 10:116726204-116726226 GGCCCAAGGAGTGTGGTGTTGGG + Intronic
1076517115 10:131052405-131052427 TCCCCAAGGAGTTTGGGGCTAGG + Intergenic
1076811882 10:132890635-132890657 TCCCTGAGGAGTTTGGGGATAGG - Intronic
1078054454 11:7995907-7995929 TACACAATGAGTGGGGGGTTGGG - Intronic
1084267522 11:68012591-68012613 AACCTAAGCAGTGTGGGGAGTGG + Intronic
1084619126 11:70256603-70256625 GAACCCAGGAGTGTGGGGGTGGG + Intergenic
1089589407 11:119530987-119531009 TCCCCAAGGAGTCTGGGGCTAGG - Intergenic
1097052219 12:56230402-56230424 TTCCCAAGGAATATGGGGATGGG + Intronic
1097186449 12:57198917-57198939 GCCCCAAGGAGGGTGGGGGTGGG + Intronic
1097872470 12:64612137-64612159 AACCCAGGGAGGGTGGGCATGGG - Intronic
1099586154 12:84517395-84517417 TATCCATGGAGTGAGGTGATTGG + Intergenic
1102077176 12:110068875-110068897 TACCAATGGGGTGTAGGGATTGG - Intronic
1102409338 12:112703782-112703804 TCCCTAAGGAGTTTGGGGCTAGG - Intronic
1102856996 12:116302685-116302707 TCTCCAAGGAGTGGGTGGATTGG - Intergenic
1104106633 12:125666356-125666378 TACCCATGGAGAGAGAGGATGGG + Intergenic
1105681130 13:22728676-22728698 GACCCAAGGGGTGTGGGGGGTGG + Intergenic
1105708976 13:22986978-22987000 TCCCCAAGAAGACTGGGGATAGG - Intergenic
1105771871 13:23619799-23619821 TGCCCAGGGAGGGTGGGGAAAGG + Intronic
1106533635 13:30618275-30618297 TTTCCAAGGAGCGTGGAGATGGG + Intronic
1107836550 13:44416374-44416396 TTCCCAAGGAGTCTGGGCACAGG + Intergenic
1107977717 13:45706012-45706034 CATCCAAAGAGTTTGGGGATGGG - Intronic
1108737025 13:53294891-53294913 TCTCCAAGGAGTCTGGGGTTAGG + Intergenic
1112569606 13:100581856-100581878 TGCCACAGGGGTGTGGGGATTGG - Intronic
1113893629 13:113749368-113749390 TCCCCGAGGAGTGTGGTGCTGGG - Intergenic
1115314619 14:32013068-32013090 TCCCCAAGGAATTTGGGGTTTGG + Intronic
1125008219 15:34841400-34841422 TACTCAAAGGGTGAGGGGATGGG - Intergenic
1126648910 15:50902142-50902164 TCCCCAAGGAATGTGGAGCTAGG - Intergenic
1127300375 15:57647191-57647213 TAAGCAAGGAGGGAGGGGATGGG + Intronic
1127824151 15:62689288-62689310 TACTCAAAAAGTGTGGGGAGTGG - Intronic
1128675598 15:69606371-69606393 TAGCAAAGGAGGATGGGGATCGG - Intergenic
1129158074 15:73731276-73731298 TAACCTGGGAGTGTGGGGAGGGG - Intergenic
1129366446 15:75058518-75058540 TAGCAAAGGAATGTGGGGAGTGG + Intronic
1129411318 15:75352059-75352081 ATCCCATGGAGGGTGGGGATGGG + Intronic
1129779478 15:78260606-78260628 TACCCAAGGAATGCTGGGATGGG - Intergenic
1129791342 15:78342434-78342456 TAGGCAAGGTGTGGGGGGATGGG - Intronic
1131966949 15:97854454-97854476 TAGCAAAGAAGTGTGGCGATGGG + Intergenic
1132597435 16:759735-759757 TACCCAAGGGCTCTGGGGAGGGG - Intronic
1133083091 16:3339017-3339039 TTTCCAAGGACTGTGGGGAGGGG - Intergenic
1137699257 16:50484647-50484669 AATCCTAGGAGTGTAGGGATGGG - Intergenic
1137886283 16:52107304-52107326 GACCCAGGGAGTGGGGGAATAGG - Intergenic
1138041223 16:53670216-53670238 TACCCAAGGAGTGTGGGGATAGG - Intronic
1139282995 16:65785783-65785805 TCCCCAAGGAGTTTGGGGCTAGG + Intergenic
1139301106 16:65946152-65946174 AAGGCAGGGAGTGTGGGGATTGG - Intergenic
1140722752 16:77786160-77786182 CACCCAAGGAGTGAGGACATAGG - Intergenic
1141344679 16:83233878-83233900 TATACAAGGAGTGTGGTGGTAGG - Intronic
1142004776 16:87684488-87684510 GCCCCAAGGACTGTGGGAATGGG - Intronic
1143136502 17:4715329-4715351 AACCCAAGGTGCGTGGGGCTGGG + Intronic
1146831091 17:36070147-36070169 TCCCCAAGGAGAGATGGGATGGG + Intronic
1147859588 17:43510386-43510408 TACCCATGGTATGTGGGGATTGG + Intronic
1148550992 17:48550744-48550766 TACCGAAGGCGGGTGGGGACGGG + Exonic
1148746011 17:49918831-49918853 CAGCCAAGGAGTGTGGGGGTAGG + Intergenic
1149626689 17:58084526-58084548 TTCCCAAGGAGGGAGGGGCTAGG + Intronic
1149867020 17:60156758-60156780 TCCCCAAGGACTGAGAGGATGGG + Intronic
1150450591 17:65263840-65263862 TAGCCAAGGCATCTGGGGATGGG + Intergenic
1151334904 17:73434087-73434109 AATCCAAGCAGTGTGGGGACTGG - Intronic
1152805968 17:82356502-82356524 CACCCCAGGATGGTGGGGATGGG + Intergenic
1153230565 18:2931367-2931389 TTCCCACGGACTGTGGGGACTGG + Exonic
1153802642 18:8684776-8684798 TCCCCAAGGAGTTTGGGGCCAGG + Intergenic
1154375392 18:13804848-13804870 TCCCCAAGGAGTTTGAGGCTAGG + Intergenic
1154514508 18:15146993-15147015 TACCCAAGGATTTTGGTGCTAGG - Intergenic
1159943527 18:74426717-74426739 TACCAGAGGAGAGTGGGGCTGGG + Intergenic
1160009868 18:75098319-75098341 ACCCCAAGGAGTTGGGGGATTGG + Intergenic
1161004467 19:1927843-1927865 TACCGAAGGGGTGTGGGGATGGG + Intergenic
1162880571 19:13655892-13655914 TCCCCAAGGAGTTTGGGGCTAGG + Intergenic
1164711437 19:30359691-30359713 TACCCAAGTGGTGTGGGGAGGGG - Intronic
1164744626 19:30601969-30601991 TTCCCAATGACTGTGGGGAGAGG - Intronic
1165145874 19:33729755-33729777 TCCCCAAGGAGTTTGGGCCTGGG + Intronic
1165737496 19:38185909-38185931 TACCCAAGGAGTGGTGTTATGGG - Intronic
926146350 2:10399154-10399176 TGCCCCAGGGGTCTGGGGATGGG - Intronic
926413093 2:12625412-12625434 TCCCCAGGGAGTCTGGGGAAGGG + Intergenic
928696620 2:33856016-33856038 TCCCCAAGGAGTTTGGGGATGGG + Intergenic
929057873 2:37894117-37894139 TAGCCAATGAGTGTGGAGCTGGG - Intergenic
929109669 2:38396133-38396155 TTCCCAAGGTTTGTGGGGAGAGG - Intergenic
929507934 2:42542966-42542988 TCCCCGAGGAGTTTGGGGCTGGG + Intronic
929742475 2:44617371-44617393 TACCTAAGGAGTGTGTGTTTAGG - Intronic
931260756 2:60616357-60616379 TACCAAAGAACTGTGGGGAGAGG - Intergenic
932344786 2:70988446-70988468 CCCCCAAGGAGGGTGGGGATGGG + Exonic
935158174 2:100502707-100502729 TACCAAAAGAGTGGGGGGAAAGG + Intergenic
937611458 2:123866645-123866667 TCTCCAAGGAGTATGGGGCTAGG + Intergenic
941042950 2:160643974-160643996 TAAACATGGAGGGTGGGGATAGG + Intergenic
945109299 2:206347370-206347392 TAGTCAAGGAGTCTGAGGATGGG + Intergenic
946291015 2:218745660-218745682 AATGCAAGGGGTGTGGGGATGGG - Intronic
1169723239 20:8701489-8701511 TACGTCAGTAGTGTGGGGATTGG - Intronic
1173225493 20:41160175-41160197 TAGCCCAGCAGGGTGGGGATGGG + Intronic
1174119162 20:48249310-48249332 TACCCTTGGAGAATGGGGATTGG - Intergenic
1174770734 20:53297720-53297742 TACACAAGGAAAGTGGGGCTTGG - Intronic
1175040366 20:56044098-56044120 TACCTAAGAAGTCTGGGGATAGG + Intergenic
1175731803 20:61359255-61359277 TTCCCTAGGAGTTTGGGGGTGGG + Intronic
1176179972 20:63745200-63745222 TGCACACGGAGTGTGGGGATAGG - Exonic
1176241351 20:64077222-64077244 TTCCCAGGGAGTGAGCGGATGGG - Intronic
1176521334 21:7826798-7826820 TACCCACTGACTCTGGGGATAGG - Intronic
1178655354 21:34456810-34456832 TACCCACTGACTCTGGGGATAGG - Intergenic
1178702847 21:34848180-34848202 TACCCAAGGAGGCTGAGGGTGGG + Intronic
1178737610 21:35166972-35166994 TGCCTAAGGAGTGTGGGGCTAGG - Intronic
1179599256 21:42465100-42465122 TCCCCAAGGAGTGTGGGGCTAGG + Intergenic
1180167658 21:46038276-46038298 TTCCCAAGGTGTGTGGGGGACGG + Intergenic
1183604196 22:38859283-38859305 AAGCCAAGGAGTAGGGGGATGGG - Intergenic
1184381489 22:44147495-44147517 TAGACAAGGAGTGTGGGAACAGG + Intronic
949111926 3:271159-271181 TTCCTAAGGATTGTGGGGAGGGG + Intronic
950324197 3:12089829-12089851 TACCCAAGGTTTGTGGGTGTAGG + Intronic
950394867 3:12726299-12726321 CACCCAAGGTGAGTGGAGATTGG + Intergenic
951538635 3:23761974-23761996 TCCCCAAGAAGTGGGGGCATAGG + Intergenic
954416538 3:50396050-50396072 AACCCTAGGAGTGTGAGGCTGGG - Intronic
954800280 3:53183272-53183294 TCCCCAGGGAGGGTGGGGAGAGG - Intronic
954984851 3:54780807-54780829 TACTAAAGGAGTGGGGGGGTTGG + Intronic
956966323 3:74465363-74465385 CAGTCAAAGAGTGTGGGGATTGG + Intronic
959195508 3:103175606-103175628 TCCCCAAGGAGTCTGGGACTAGG + Intergenic
960490278 3:118309018-118309040 TACCCTTGGAGTGAAGGGATAGG - Intergenic
960597691 3:119421639-119421661 AAACCAAAGAGTGTGCGGATCGG - Intergenic
962086915 3:132201009-132201031 TTCCCAAGGAGTGTGGTCAGAGG + Intronic
963292816 3:143510813-143510835 TAGGCAAGGTGTGTGGGGAAAGG + Intronic
964454124 3:156842098-156842120 TTCCCATGGACTGGGGGGATGGG - Intronic
964586600 3:158313101-158313123 TAACCAAGGGGTGAGGGGAGGGG - Intronic
965289757 3:166864740-166864762 TGCACACGGAGTGTGGGGACTGG + Intergenic
966434719 3:179870431-179870453 TCCCCGAGGAGTTTGGGGCTAGG - Intronic
966600937 3:181774408-181774430 TACCCAAGGTATGTGGGAACTGG + Intergenic
967036158 3:185649635-185649657 GTCCCAGGGAGTGTGGGAATGGG - Intronic
967408032 3:189138903-189138925 TCCCCAAGGAGTGTGGCCACAGG - Intronic
969049180 4:4360547-4360569 TCCCCAGGGAGTTTGGGGCTGGG - Intronic
969990931 4:11261454-11261476 TCCCCAAGGAGTATGAGGAGAGG - Intergenic
970658900 4:18262359-18262381 AACCAAAGGAGTTTGGGGTTTGG + Intergenic
972204172 4:36751584-36751606 TAGCATAGGAGAGTGGGGATAGG - Intergenic
976806436 4:89052456-89052478 TACCCAGGGGGTGGGGGGAGGGG - Intronic
982236205 4:153253380-153253402 TACCCAGTGTGTGTGGGGGTGGG - Intronic
983083561 4:163415819-163415841 TCCCCAGGGAGTTTGGGGCTAGG + Intergenic
983640701 4:169941766-169941788 TCCCCAAGGAGTGTGGGCCTAGG - Intergenic
983888678 4:173008600-173008622 TCCCCAAGGAGTTTGGGGCTAGG + Intronic
984905394 4:184621349-184621371 TCCCCAAGGAGTTTGGGGCTCGG - Intergenic
986047002 5:4048441-4048463 TCCCCAAGGAATGTGGAGTTAGG - Intergenic
986401389 5:7384870-7384892 TCCCCTAGGAGTGAGGGGAAGGG - Intergenic
986519308 5:8596622-8596644 TACCCCAGGAGTCCGGGGAGAGG + Intergenic
988655298 5:33204775-33204797 TACCCAACCTGTGTGGGCATAGG + Intergenic
990313990 5:54567072-54567094 AGCCCAAGGAGAGTGGGGGTGGG - Intergenic
992961564 5:81960858-81960880 GAGCCAAGGAGTGTTGGGGTGGG - Intergenic
995543100 5:113203261-113203283 TGCCCAAGAGGTGTGGGGATGGG + Intronic
995657655 5:114444807-114444829 CACCAAATGAGTCTGGGGATTGG + Intronic
996871744 5:128200235-128200257 TACAGGAGGAGTGTGGTGATGGG - Intergenic
998146477 5:139731887-139731909 TACTCAAGGTGGGAGGGGATAGG - Intergenic
1000062127 5:157667152-157667174 CACCCAAGAAGTGGAGGGATGGG + Intronic
1002165670 5:177343771-177343793 TTACCAGGGACTGTGGGGATGGG + Intronic
1003634656 6:7821225-7821247 GACCCAAGAACTGTGGGGATTGG + Intronic
1004378929 6:15115566-15115588 TATCCAAGGAGTCTGGGGCAAGG - Intergenic
1004772679 6:18801851-18801873 TTCACAAGGAGTGTGAGGAAAGG - Intergenic
1005560422 6:27034939-27034961 TACCCACGGGGTTTGGGGAGAGG - Intergenic
1005637094 6:27762712-27762734 GACCCAGGGACTGTGGGGCTGGG + Intergenic
1005950983 6:30631093-30631115 TACTCAAGTAAGGTGGGGATGGG + Intronic
1009505078 6:64467875-64467897 CACTCAAGGGGTTTGGGGATTGG + Intronic
1010256599 6:73765248-73765270 TAGCCCAGGAGTGAGGGGATGGG + Intronic
1010257786 6:73779083-73779105 TTCCCAAGGGCTGTGGGGAAGGG - Intronic
1010662275 6:78585043-78585065 GAGCAAAGGAGTTTGGGGATTGG - Intergenic
1010980176 6:82363260-82363282 TACCCAAGAAGTGAGGGGGCGGG + Intronic
1011229264 6:85141615-85141637 TCCCCAAGGAGTTTAGGGATAGG - Intergenic
1012550158 6:100458176-100458198 AACCCAAGGAGGGCGGGGTTCGG + Intronic
1012777104 6:103511135-103511157 TAATCAAGAAGTGTGGTGATTGG + Intergenic
1013202692 6:107916100-107916122 TACCTAAAGACTGGGGGGATAGG + Intronic
1016040790 6:139429968-139429990 TACACAAGGAGTGTGGTGGTGGG + Intergenic
1020261965 7:6535867-6535889 TCCCCAAGGAGAGTTCGGATGGG - Intronic
1023706103 7:42943256-42943278 TACCCAATGATTGTGGCAATTGG + Intronic
1024156021 7:46626365-46626387 AACCCAAGGAGAGAGAGGATGGG + Intergenic
1027914815 7:84303123-84303145 CACCCAGTGAGGGTGGGGATTGG - Intronic
1031101524 7:117486534-117486556 TATCCAAAGAGGGTAGGGATGGG + Intronic
1031292743 7:119958473-119958495 TCCCCAAGGAATTTGGGGCTAGG + Intergenic
1032399220 7:131611948-131611970 GACCAAAGGAGTGTGGGCACTGG - Intergenic
1038922160 8:32096752-32096774 TACCCAGGGAGTGGGGAGATCGG - Intronic
1039071131 8:33650316-33650338 AAGCCTAGGAGTTTGGGGATGGG - Intergenic
1039119567 8:34130608-34130630 TCCCCAAGGAGTTTTGGCATGGG - Intergenic
1040974059 8:53170355-53170377 TAACCAAGGAGTTCTGGGATGGG - Intergenic
1041829868 8:62142394-62142416 TAGCCAAGGAATATGGAGATAGG + Intergenic
1042769310 8:72362124-72362146 AACTCGAGGAGTTTGGGGATAGG + Intergenic
1043107803 8:76136832-76136854 TAACCAGGGAGTGATGGGATCGG - Intergenic
1046296942 8:112232059-112232081 GGCCTATGGAGTGTGGGGATTGG + Intronic
1049173175 8:141174689-141174711 TAACCAAAGAGTGTGGAGGTCGG + Intronic
1049240543 8:141535528-141535550 TCCCCCAGGAGTGTGGGGTCAGG - Intergenic
1055871489 9:80886001-80886023 TCCCCAAGGAGTCTGAGGGTAGG - Intergenic
1056242956 9:84668172-84668194 TACCCGCAGAGTTTGGGGATGGG - Intergenic
1056372347 9:85969296-85969318 TACCAAATAAGTGTGAGGATAGG - Intronic
1056574109 9:87842275-87842297 GACCCTAGGAGGGTGGGGACTGG - Intergenic
1057209583 9:93192545-93192567 CACCCCAGGAGTGCAGGGATGGG + Intronic
1058857742 9:109081531-109081553 TGCCCAAGGAGCGAGGGGTTGGG + Intronic
1059626864 9:116076631-116076653 TGCCAAAGGAGTGTGGGGGAGGG - Intergenic
1060020700 9:120128145-120128167 TAGCCAGGGAGAGTTGGGATTGG + Intergenic
1060592681 9:124828712-124828734 TTGCCAAGGACTGAGGGGATAGG + Intergenic
1060757857 9:126225958-126225980 TACCCAGGGTGTGTGGGAAAAGG + Intergenic
1061373132 9:130209059-130209081 TCTCCAGGGAGTGTGGGGAGGGG + Intronic
1061611521 9:131749781-131749803 CACCCAAGGAGAGTGGAGGTGGG - Intergenic
1186280596 X:7988863-7988885 TCTCCAAGGAGTTTGGGGCTAGG - Intergenic
1186352847 X:8757505-8757527 TCTCCAAGGAGTTTGGGGCTAGG + Intergenic
1186979239 X:14941232-14941254 TCTCCAAGGAGTCTGGGGCTAGG + Intergenic
1187156455 X:16724541-16724563 TCTCCAAGAAATGTGGGGATGGG + Intronic
1187179923 X:16934515-16934537 TACCCAAGAAGTGAGGAGTTTGG - Intergenic
1187741080 X:22355982-22356004 TTCCGAAGGGGTGTGGGGAGAGG + Intergenic
1187955074 X:24509550-24509572 TACCCCATGAGTGTGGAGGTGGG - Intronic
1189690902 X:43615994-43616016 TACCCAAGAAGTTTGTGAATGGG + Intergenic
1189927645 X:45973393-45973415 TGCCCAAGAAGTGTTGGGGTGGG + Intergenic
1190842978 X:54163502-54163524 TTGCCAGGGATTGTGGGGATGGG + Intronic
1195477064 X:105299392-105299414 TCCCCAAGGAGTTTGGAGCTAGG + Intronic
1195651327 X:107288071-107288093 TAGCCAAGGGCTGTGGGGAGGGG - Intergenic
1195757698 X:108215649-108215671 TAGCCAAGGAGGGAGGGCATGGG - Intronic
1196245981 X:113401040-113401062 TCCCCAAGGAGTTTGGGGCTAGG + Intergenic
1198727665 X:139693429-139693451 TACCTGAGGAAAGTGGGGATAGG + Intronic