ID: 1138041889

View in Genome Browser
Species Human (GRCh38)
Location 16:53680362-53680384
Sequence AGATGTGCCCTTTAAATTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 123}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138041880_1138041889 3 Left 1138041880 16:53680336-53680358 CCCAGTTACCCCTCCATCAGAGA 0: 1
1: 0
2: 0
3: 6
4: 92
Right 1138041889 16:53680362-53680384 AGATGTGCCCTTTAAATTAGGGG 0: 1
1: 0
2: 0
3: 7
4: 123
1138041884_1138041889 -7 Left 1138041884 16:53680346-53680368 CCTCCATCAGAGAACCAGATGTG 0: 1
1: 0
2: 0
3: 13
4: 175
Right 1138041889 16:53680362-53680384 AGATGTGCCCTTTAAATTAGGGG 0: 1
1: 0
2: 0
3: 7
4: 123
1138041879_1138041889 9 Left 1138041879 16:53680330-53680352 CCTGGTCCCAGTTACCCCTCCAT 0: 1
1: 0
2: 0
3: 11
4: 188
Right 1138041889 16:53680362-53680384 AGATGTGCCCTTTAAATTAGGGG 0: 1
1: 0
2: 0
3: 7
4: 123
1138041882_1138041889 -5 Left 1138041882 16:53680344-53680366 CCCCTCCATCAGAGAACCAGATG 0: 1
1: 0
2: 0
3: 12
4: 177
Right 1138041889 16:53680362-53680384 AGATGTGCCCTTTAAATTAGGGG 0: 1
1: 0
2: 0
3: 7
4: 123
1138041881_1138041889 2 Left 1138041881 16:53680337-53680359 CCAGTTACCCCTCCATCAGAGAA 0: 1
1: 0
2: 0
3: 4
4: 123
Right 1138041889 16:53680362-53680384 AGATGTGCCCTTTAAATTAGGGG 0: 1
1: 0
2: 0
3: 7
4: 123
1138041885_1138041889 -10 Left 1138041885 16:53680349-53680371 CCATCAGAGAACCAGATGTGCCC 0: 1
1: 0
2: 0
3: 13
4: 158
Right 1138041889 16:53680362-53680384 AGATGTGCCCTTTAAATTAGGGG 0: 1
1: 0
2: 0
3: 7
4: 123
1138041883_1138041889 -6 Left 1138041883 16:53680345-53680367 CCCTCCATCAGAGAACCAGATGT 0: 1
1: 0
2: 0
3: 19
4: 197
Right 1138041889 16:53680362-53680384 AGATGTGCCCTTTAAATTAGGGG 0: 1
1: 0
2: 0
3: 7
4: 123
1138041878_1138041889 10 Left 1138041878 16:53680329-53680351 CCCTGGTCCCAGTTACCCCTCCA 0: 1
1: 0
2: 0
3: 16
4: 233
Right 1138041889 16:53680362-53680384 AGATGTGCCCTTTAAATTAGGGG 0: 1
1: 0
2: 0
3: 7
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138041889 Original CRISPR AGATGTGCCCTTTAAATTAG GGG Intronic
906888083 1:49674331-49674353 TGCTGGGCCCTTTAAAGTAGAGG - Intronic
909128732 1:71708195-71708217 ATATGTGCCCTTTCAAACAGAGG + Intronic
909484817 1:76160982-76161004 AGATGGGTCCTTTACATAAGTGG - Intronic
911297143 1:96131914-96131936 AGATGGACCCATTAAATTGGAGG - Intergenic
914804141 1:150980522-150980544 AAAAGTGCCCTGTAAAGTAGGGG - Intergenic
915860655 1:159440808-159440830 AGACCTGCCCCTTAAATAAGAGG + Exonic
1066360270 10:34723505-34723527 AGAGGTGACCTTAAAATTTGGGG - Intronic
1067742364 10:48905299-48905321 AGCTGTGCCCACTAAGTTAGAGG + Intronic
1068224340 10:54087185-54087207 AATTGTACCCTTTAAATTGGTGG - Intronic
1072478736 10:95789241-95789263 AGATATGCTCTTTAAATTATTGG + Intronic
1077161047 11:1113063-1113085 TGCTGTGCCCTTTAAAGCAGAGG + Intergenic
1077849503 11:6061989-6062011 GGATGTGCCCTTTAAAGTCTTGG + Intergenic
1078629821 11:12992161-12992183 AGATCTGCCCTTGATATTGGTGG - Intergenic
1080049421 11:27843894-27843916 ACATGAGCCCTTTAAAGTAAAGG + Intergenic
1081236962 11:40658150-40658172 ATATGTGTCCTTTATATTATAGG + Intronic
1082061490 11:47864589-47864611 AAATGTGCCCTTTATCTTTGAGG - Intergenic
1082675641 11:56098546-56098568 ATATTTGCCTTTTAAAATAGGGG + Intergenic
1083886689 11:65576559-65576581 AGAAGTGCCCTTGCAATTTGTGG + Intronic
1087028637 11:93679858-93679880 ATATGTGCTCTATAAATTTGAGG + Intronic
1089535684 11:119159678-119159700 AGATGTGCCCTATGGATTACTGG - Intronic
1091893585 12:4082847-4082869 AGATGAGCCCTTCAAAATAATGG + Intergenic
1095328499 12:40927685-40927707 AGATGTGGCCTTTGGATTTGTGG - Intronic
1099144263 12:79019031-79019053 ACATGTGTCCATTAAATTAAGGG + Intronic
1106497695 13:30296181-30296203 GGATGTGGCCTTGAAGTTAGGGG - Intronic
1109316819 13:60758988-60759010 AAAAGTGCCCTTGAAATCAGTGG - Intergenic
1109558203 13:64009379-64009401 AGATGTGCCTTTTATAGGAGTGG - Intergenic
1109843781 13:67956763-67956785 AGATGTGGCATTGAAATCAGAGG - Intergenic
1109938731 13:69330292-69330314 AAATGTGCCTTCTAAAGTAGGGG - Intergenic
1112045027 13:95587795-95587817 AGATGTGCCTCTTAAAGTGGTGG + Intronic
1112762783 13:102709934-102709956 AGGTGTGCAGTTTCAATTAGAGG - Intergenic
1115099544 14:29682199-29682221 AGATGTGGCATTTAAATTTTTGG - Intronic
1115401222 14:32962977-32962999 AAATGTGCACTTTAAAATTGTGG - Intronic
1117427619 14:55617465-55617487 AGATGTGCCATGGAAATTAGAGG + Intronic
1122360246 14:101155257-101155279 AGATGTTTCATTTTAATTAGGGG + Intergenic
1125143074 15:36432664-36432686 AAAAGTGCCCTTTAAATTCAAGG - Intergenic
1125806667 15:42499051-42499073 AGATGTGACCTTTAGTTAAGTGG - Intronic
1128121054 15:65146825-65146847 AGATGTCCCTTTTAAATTGTTGG - Intergenic
1130388121 15:83430520-83430542 AGCTATGCACTTTAAGTTAGAGG + Intergenic
1130629620 15:85553663-85553685 AGATTTGTACTTTAAATCAGGGG + Intronic
1131648358 15:94371384-94371406 ACATGTGCCTTTGACATTAGTGG + Intronic
1138041889 16:53680362-53680384 AGATGTGCCCTTTAAATTAGGGG + Intronic
1140171431 16:72608910-72608932 AGTTGTGCCCTTTAAATGAATGG + Intergenic
1143691482 17:8570750-8570772 ACATGAGGCTTTTAAATTAGTGG + Intronic
1147708582 17:42446553-42446575 AGATCTACCCTTTAAAAAAGTGG + Intergenic
1148170360 17:45514380-45514402 AGTTGTGTCTTTTATATTAGTGG + Intergenic
1148170837 17:45518373-45518395 AGTTGTGTCTTTTATATTAGTGG + Intergenic
1148365188 17:47050182-47050204 AGTTGTGTCTTTTATATTAGTGG - Intergenic
1149490303 17:57079817-57079839 ACATGTGCCCCTGAAATTGGAGG + Intergenic
1152456830 17:80421636-80421658 AGATGTACCCTGCAAATTGGTGG - Intronic
1155344453 18:24844833-24844855 AATTGTGCACTTTAAATGAGTGG - Intergenic
1158784819 18:60697873-60697895 AAATGTGATCTTTAATTTAGTGG + Intergenic
1158839325 18:61367130-61367152 GGATGTTCCCTTTACATGAGAGG - Intronic
1159265964 18:66079489-66079511 AGAAGTGCCATTTAAATGAATGG - Intergenic
1159370788 18:67525237-67525259 AGATGTGCTCTTGAAAATACTGG - Intergenic
1159926814 18:74277079-74277101 AGATAAGCTCTTTAAATTAAAGG - Intronic
1164898171 19:31895745-31895767 AAATCTGCTCTTTCAATTAGCGG - Intergenic
1166961567 19:46499705-46499727 AGTTGTGCACTTTAAATGGGTGG - Intronic
926003248 2:9351454-9351476 TCATGGGCCCTTTAATTTAGGGG - Intronic
929572542 2:43031832-43031854 ACTTGTGCCCTTGAAAATAGGGG + Intergenic
931757281 2:65385352-65385374 AGATTTCCCCTTTACATAAGAGG + Intronic
932636398 2:73392384-73392406 AATTGTGCACTTTAAATTAAAGG - Intronic
932647541 2:73519449-73519471 AGATGTCCACCATAAATTAGGGG - Intronic
935370048 2:102335945-102335967 AGATGTTCGCCGTAAATTAGAGG - Intronic
938551590 2:132387120-132387142 AGATGATCCATTTAAATGAGAGG + Intergenic
939087797 2:137742599-137742621 TGATGTGCCCTTTCATTTAAAGG - Intergenic
940550720 2:155152413-155152435 AAATATGCCCTTTAAAATTGTGG - Intergenic
944791203 2:203128996-203129018 AGAACTACCCTTTAAGTTAGTGG + Intronic
945266888 2:207899445-207899467 AAATGTGCCCTTTCAATTTCAGG + Intronic
945959487 2:216117303-216117325 TGATGATCCCTTAAAATTAGGGG - Intronic
947214229 2:227735543-227735565 AGATATGCCCTTTATTTTGGGGG - Intergenic
1171038022 20:21732171-21732193 AGAGTGGCCCTTTAAAATAGGGG - Intergenic
1175447627 20:59034821-59034843 AGATGATCCCTTTTATTTAGAGG + Exonic
1178547671 21:33506461-33506483 AGATGTGCCATTTTGAATAGGGG + Intronic
949512491 3:4779036-4779058 AGATGTACTCATTATATTAGGGG + Intronic
950275395 3:11656321-11656343 AGGTGTGCCTTTTATATGAGTGG + Intronic
954054059 3:48007281-48007303 AGATATTCCCTTTAAGTTAAAGG + Intronic
956259029 3:67316667-67316689 AGATTTGCCCTTTAAGTAAAAGG - Intergenic
956283080 3:67579209-67579231 ATATGAGCCCTTTAACTTACTGG - Intronic
956357978 3:68414909-68414931 AGAGGTGACTTTAAAATTAGTGG + Intronic
959749585 3:109817714-109817736 AGATGTTCTCCTTTAATTAGAGG + Intergenic
966061360 3:175760360-175760382 AGATGTCCCCTTGAAAACAGAGG - Intronic
967078855 3:186030277-186030299 ACGTGAGCCCTTAAAATTAGGGG - Intergenic
968272689 3:197416628-197416650 ATATGTGCCCTTTAGATAAGAGG - Intergenic
970434423 4:16019663-16019685 AGATGTGAAATTTAAATTAGAGG + Intronic
971014183 4:22470521-22470543 AGCTGTGGCCTTGAAATTATAGG - Intronic
971513554 4:27458342-27458364 AGATGTGCACTATAAATCCGAGG - Intergenic
974134182 4:57793743-57793765 AAATGTGCCCTTTGATATAGGGG - Intergenic
977775588 4:100915688-100915710 AGTTATGACCATTAAATTAGTGG - Intergenic
978059567 4:104321278-104321300 AGATGTGCTGTTTAAATTTTAGG + Intergenic
978161471 4:105553104-105553126 AAATGTGACCTATAAATTATAGG + Intronic
978732239 4:112041853-112041875 ATATGGGCCCTTTAAATTTATGG + Intergenic
985246888 4:187988021-187988043 AGATGTGCATTTTAAAGTATTGG + Intergenic
986183060 5:5411665-5411687 AGTTGTGCACTTTAAATATGTGG - Intergenic
990110504 5:52317430-52317452 AAATCTGTCCTTTAAATTAGTGG - Intergenic
991920284 5:71649982-71650004 ATGTTTGCCTTTTAAATTAGTGG - Intronic
992321768 5:75620566-75620588 ATATGTGCTCTTTGAATTTGGGG + Intronic
993399014 5:87426024-87426046 AGATATTCTTTTTAAATTAGTGG + Intergenic
995128207 5:108601107-108601129 AGCTTTACCCTTTAAATCAGCGG + Intergenic
999409299 5:151336387-151336409 AGATCTGCTTTTTAATTTAGTGG + Intronic
1003168215 6:3699846-3699868 GGCTGTGCCCTTTAATTTGGGGG + Intergenic
1006558967 6:34892424-34892446 AGATTTGGCCTTTGTATTAGCGG + Intronic
1007854115 6:44836410-44836432 AGCCCTGCCCTTTAAATAAGAGG + Intronic
1008539837 6:52537063-52537085 AGATTTGCTCTTTAAAGGAGAGG - Intronic
1009474892 6:64078378-64078400 AGGTGTGTCCCTTAACTTAGGGG - Intronic
1010070858 6:71743666-71743688 ACATGTGCCCTTTAATCTGGAGG - Intergenic
1012024265 6:93968119-93968141 AAATGTGCCCTTTAAGTAGGAGG - Intergenic
1012218461 6:96618266-96618288 AGATGTCACCTTTGAATTACTGG - Intergenic
1012265519 6:97137484-97137506 AAATGGGCCCTTGAAATTTGGGG - Intronic
1015066913 6:129041053-129041075 AGCTGTGCCATTTAAATTCTGGG + Intronic
1017438123 6:154436943-154436965 ATATGTATCCTTCAAATTAGAGG + Intronic
1021416612 7:20393538-20393560 AGCGGTGCCCTCTGAATTAGAGG + Intronic
1022260774 7:28702783-28702805 AGATTTGGCCTTTAATTTGGGGG + Intronic
1026479475 7:70765477-70765499 AGATCTGCCCTTAAAATTCTGGG - Intronic
1027805824 7:82821048-82821070 AGATGAGAGCTTTAAATTTGGGG + Intronic
1028704180 7:93818926-93818948 AGATGTGTCCTTTAAATGGTTGG + Intronic
1030050606 7:105533637-105533659 AGATTTGCCCTTAACATTAGCGG + Intronic
1031067955 7:117127521-117127543 AGTTATGCCCTTTAAATTGAAGG - Intronic
1031891327 7:127296357-127296379 AGATGATCCCTTTTATTTAGAGG - Intergenic
1033149395 7:138900043-138900065 ACATGTGCCATTTAAATTGCTGG + Intronic
1046105976 8:109666941-109666963 AGATGGGATATTTAAATTAGAGG - Intronic
1046900035 8:119513959-119513981 ACATCTGCCATTTAAATAAGAGG + Intergenic
1050060116 9:1699513-1699535 AGAAATGCCCTAGAAATTAGGGG - Intergenic
1051191849 9:14521269-14521291 AGATTTGACCTTTTAGTTAGAGG - Intergenic
1051840557 9:21392878-21392900 AGAGGTTCCCTTTAAATATGGGG - Intergenic
1052570138 9:30210412-30210434 GGATATGCACTTTAAAATAGTGG - Intergenic
1055266855 9:74502567-74502589 TAATATGCACTTTAAATTAGAGG - Intronic
1055816984 9:80218405-80218427 ATATATGCCATTTAAATCAGGGG + Intergenic
1188140939 X:26550253-26550275 AGATGTTGCCTTTAAATGTGAGG + Intergenic
1188309240 X:28597021-28597043 AGATGTGACCTTCTAAATAGAGG + Intronic
1188364587 X:29299492-29299514 AGATGTCACCTTTAAATAATAGG + Intronic
1199054053 X:143271456-143271478 ACATGGGCCCTTAAAATTGGAGG - Intergenic