ID: 1138041902

View in Genome Browser
Species Human (GRCh38)
Location 16:53680434-53680456
Sequence TCAATGGGCTATAAAAGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 159}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138041898_1138041902 7 Left 1138041898 16:53680404-53680426 CCAAACTGAGGGACATTCTGCAT 0: 1
1: 6
2: 57
3: 223
4: 666
Right 1138041902 16:53680434-53680456 TCAATGGGCTATAAAAGAGTGGG 0: 1
1: 0
2: 0
3: 12
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138041902 Original CRISPR TCAATGGGCTATAAAAGAGT GGG Intronic
904971020 1:34419513-34419535 TCAATGGGCTATGCAAGGGCGGG + Intergenic
905805820 1:40876825-40876847 TCAATGTGCTATGAAAGAGAGGG - Intergenic
910151092 1:84147361-84147383 TCAATGGGCTAACAAATAGGAGG - Intronic
910152238 1:84163575-84163597 TGACTGAGCTATAAAGGAGTGGG + Intronic
911692274 1:100847902-100847924 TCAATAGCCTACAATAGAGTAGG + Intergenic
916102289 1:161402836-161402858 GCAATGGGATAGTAAAGAGTTGG - Intergenic
921353473 1:214261793-214261815 TCAATGGGCTAAATAGGTGTGGG + Intergenic
924889770 1:248262153-248262175 TCAATTGGCTGTAAATGTGTAGG + Intergenic
924898140 1:248364788-248364810 TCAATTGACTATAAATGTGTGGG - Intergenic
1062975738 10:1681183-1681205 TAAATCAGCTAAAAAAGAGTTGG - Intronic
1065369525 10:24969850-24969872 GCAAAAGGATATAAAAGAGTGGG - Intergenic
1068662823 10:59640622-59640644 TCAAGGGACTATAACATAGTTGG + Intergenic
1071039871 10:81294228-81294250 TCAATAAGCTGTAAATGAGTGGG + Intergenic
1071110893 10:82154370-82154392 TCAATTGACTATAAATGTGTGGG + Intronic
1074710810 10:116176098-116176120 TCCTTGGGCTATAAAAGCATAGG - Intronic
1078332269 11:10434284-10434306 TCAATTGGCTATAAATACGTGGG - Intronic
1089652435 11:119923042-119923064 TGAATGGTCTAGAAAAGAGTGGG - Intergenic
1091175321 11:133552688-133552710 TCAATTTGCTATCAAAGAGCAGG - Intergenic
1091700542 12:2656773-2656795 TCAACTGGCTGTAAATGAGTGGG - Intronic
1091919573 12:4293648-4293670 TCAATGAGCTATTAAAAAGCAGG + Intronic
1094283932 12:28771046-28771068 TTAAAGGGCTACAAAAGACTGGG + Intergenic
1094384460 12:29878942-29878964 TGAATGAACTATAAAAGAGTGGG - Intergenic
1097520508 12:60663456-60663478 TATATGGGATATAATAGAGTGGG - Intergenic
1098125393 12:67286952-67286974 TCAATTGACTATAAAAGTGTGGG + Intronic
1099325323 12:81207890-81207912 GCAATGTGCTATAAGGGAGTAGG + Intronic
1099625018 12:85060892-85060914 ACAATGGGCTGTAAAGGATTTGG + Intronic
1099947543 12:89261904-89261926 TCAATGGATTCTAAAAAAGTTGG - Intergenic
1102534911 12:113574373-113574395 GCAAAGGGCCATAACAGAGTTGG + Intergenic
1110027783 13:70563766-70563788 TATATGTACTATAAAAGAGTAGG - Intergenic
1110097649 13:71549808-71549830 TGAATAGGCTACAAGAGAGTGGG - Intronic
1110245971 13:73324882-73324904 TCAATGGGCTCAACAAGAGAGGG - Intergenic
1111093773 13:83482382-83482404 TGAATTGACTATAAAATAGTAGG + Intergenic
1111832580 13:93347994-93348016 TCAAGGGGCTTTAAAACTGTAGG - Intronic
1111885500 13:94015797-94015819 TCAATTGGCCATAAATGTGTGGG + Intronic
1112667577 13:101594274-101594296 TCAATTGGCTATAAATGTATGGG - Intronic
1114230166 14:20774165-20774187 TAAATGGGATAAAAAAGTGTTGG + Intergenic
1114238342 14:20842260-20842282 TCAATGGCCTGTAAACGAGGAGG + Intergenic
1116316600 14:43404196-43404218 TCAATTGGCCATAAAAGCCTAGG - Intergenic
1119916503 14:78406909-78406931 TCAATGGGCTATTAGAGTGCAGG - Intronic
1119957391 14:78813793-78813815 TCAATGGGCCATGAGAGAGAAGG + Intronic
1123784670 15:23658590-23658612 TCAGTTGGCTCTAAATGAGTGGG - Intergenic
1127186632 15:56487151-56487173 TCTATTGGCTATAAAATATTAGG - Intergenic
1127629246 15:60811243-60811265 TCGATGGGCTAAAAATAAGTTGG - Intronic
1130713339 15:86306230-86306252 CCATTGGGCTATCAAATAGTAGG + Intronic
1138041902 16:53680434-53680456 TCAATGGGCTATAAAAGAGTGGG + Intronic
1138142862 16:54583404-54583426 TCCATGGGCCATCAAAAAGTGGG - Intergenic
1144380578 17:14693554-14693576 TCTCTGGGGTAGAAAAGAGTTGG - Intergenic
1148180753 17:45602944-45602966 TCAAAGGTTTATAATAGAGTAGG + Intergenic
1148268150 17:46242982-46243004 TCAAAGGTTTATAATAGAGTAGG - Intergenic
1148378101 17:47168465-47168487 TCAAAGGTTTATAATAGAGTAGG - Intronic
1151437718 17:74108403-74108425 CCAATGGGTTAAAAAAGAGAAGG + Intergenic
1153574018 18:6502866-6502888 ACAATGGGCTATCATAGAGCAGG + Intergenic
1159585210 18:70277488-70277510 TCAAAAGGCAAGAAAAGAGTGGG + Intergenic
1164923113 19:32104554-32104576 TGAATGGGCTATAAATCTGTCGG - Intergenic
1165280165 19:34790149-34790171 TCAATTGGCTCTAAATGTGTGGG + Intergenic
927352639 2:22135551-22135573 CCAATAGAATATAAAAGAGTTGG + Intergenic
927510217 2:23639742-23639764 CCAATGGGAGATAAAAGAGAGGG - Intronic
928730556 2:34226978-34227000 GCAATGAGCTATCAAAGACTAGG + Intergenic
928849634 2:35729628-35729650 TCAATGCGTTTTAAAAGAATGGG + Intergenic
929912411 2:46101388-46101410 CCAATGGGCTAAGTAAGAGTTGG + Intronic
931263155 2:60637842-60637864 ATAAGGGGCTATAACAGAGTGGG + Intergenic
933293343 2:80461986-80462008 TCACTGGGCAATAAAAGGTTTGG + Intronic
935074508 2:99727914-99727936 TCTATGGGGTATAAAATAGGGGG - Intronic
936728011 2:115346196-115346218 TCAATGGGAAATATATGAGTAGG + Intronic
936852411 2:116916822-116916844 TCAAGGAGTTATAAAAGAATGGG + Intergenic
937581963 2:123498352-123498374 TCATTGGGCAATAAAAGGGGTGG + Intergenic
937853649 2:126657149-126657171 TCAAAGACTTATAAAAGAGTTGG - Intronic
938904286 2:135823996-135824018 TCAATGGTCTGAAAAAGAGAAGG + Exonic
941467680 2:165849267-165849289 TCAGTTGGCTATAAAAATGTGGG + Intergenic
941986970 2:171519852-171519874 TCAGTGGGATATAAAAGTCTGGG + Intergenic
942652705 2:178185153-178185175 TCAATTGACTATAAAAGTGTGGG - Intergenic
943896560 2:193369964-193369986 TGCATGGGTTATAAAAGACTAGG - Intergenic
944998080 2:205317354-205317376 TCTATGGGCTAAAATAGAATGGG + Intronic
946060041 2:216933943-216933965 TCAATAGGCTACGAAAGAGCTGG + Intergenic
947332986 2:229049874-229049896 TAAACTGGTTATAAAAGAGTTGG - Intronic
1172896506 20:38304150-38304172 CCAGGGAGCTATAAAAGAGTCGG - Exonic
1174158928 20:48536605-48536627 TCAATGGTCTATAGGGGAGTTGG - Intergenic
1175612025 20:60359413-60359435 TCATTTGGCCATAAAATAGTAGG + Intergenic
1177194921 21:17894038-17894060 TCAATGAGCTATCAAAGTTTTGG - Intergenic
1177843491 21:26260898-26260920 TCAATGAGCCATATAAGTGTAGG + Intergenic
1178182103 21:30173211-30173233 ACAATGAGCAATAACAGAGTGGG - Intergenic
1179272473 21:39862017-39862039 TCAATGAGGTATATAAGTGTTGG - Intergenic
1180658966 22:17449174-17449196 TAAATGGGGGATAAAAGAGGTGG - Intronic
949172988 3:1025052-1025074 TCAGTGGGATATAATATAGTGGG + Intergenic
949604245 3:5636073-5636095 TGAATATGCTATAAAATAGTAGG + Intergenic
949704173 3:6796906-6796928 TATAGGGGCAATAAAAGAGTTGG + Intronic
952989829 3:38822011-38822033 TCACTGGGGTATGAAAGAATGGG - Intergenic
953230840 3:41063498-41063520 TCAAGGGCATATGAAAGAGTAGG + Intergenic
956919176 3:73908209-73908231 TTAATGCCTTATAAAAGAGTAGG + Intergenic
957918975 3:86723877-86723899 TCAATAAGCTAGAAAAGATTGGG - Intergenic
958152760 3:89712505-89712527 CCAATGGGGACTAAAAGAGTAGG + Intergenic
958633808 3:96716062-96716084 TCAATTGACTATAAATGTGTGGG - Intergenic
959637014 3:108586862-108586884 GCATGGGGCTATAAAAGTGTGGG + Intronic
959645349 3:108693333-108693355 TTAAGGGGATATAAAAGAATGGG - Intronic
960478165 3:118157196-118157218 TCAATTGACTATAAATGTGTGGG - Intergenic
960624864 3:119672952-119672974 TCACTGAGCTATAAAAAAGGAGG - Intronic
961513190 3:127416388-127416410 TCAATTGGCCATAAATGTGTGGG - Intergenic
964481874 3:157146920-157146942 TCATTAGGATATAAAAGTGTTGG - Intronic
966181925 3:177196661-177196683 AAAATAGGCTATAAAGGAGTCGG + Intronic
972159121 4:36200553-36200575 TCCATGTGCTAGAAAAGAGGAGG - Intronic
972891273 4:43558927-43558949 TCAATGAGATATGAAAAAGTTGG - Intergenic
973571285 4:52242217-52242239 TCATTGGGAAATAAAACAGTGGG + Intergenic
974557692 4:63472690-63472712 TCATTGGGCAATAAAAGAAGTGG - Intergenic
975058381 4:69964996-69965018 TTAATGGGGTAGAAAAGACTTGG - Intergenic
975081410 4:70284753-70284775 CCAATGGGCTATCAAATACTAGG - Intergenic
975241935 4:72070215-72070237 TCAATGAGCTATATATGAGAAGG - Intronic
976369231 4:84267800-84267822 TTAATGGTCATTAAAAGAGTAGG - Intergenic
977658239 4:99549638-99549660 TGAAGGGGCTAAAAAAGAGTAGG - Intronic
978368562 4:108007659-108007681 TAAATGGGCCATAACAGAGATGG - Intronic
979013682 4:115403656-115403678 TCAAGTGACTATAAAAGTGTGGG + Intergenic
980793293 4:137647962-137647984 TAAATAAGCTATAATAGAGTTGG - Intergenic
982173339 4:152682474-152682496 TCCATGGGCCATAAAAGAAGAGG + Intergenic
982442768 4:155456276-155456298 TCAATTGGTTAAAAAATAGTAGG + Intergenic
983714289 4:170757969-170757991 TCAATGGGCTATAAATATATAGG + Intergenic
984376234 4:178934065-178934087 TCTATGGGATATTTAAGAGTGGG - Intergenic
984671922 4:182499485-182499507 CCCATGGGCTCTAATAGAGTTGG - Intronic
986800651 5:11256771-11256793 TCAAGGTGGGATAAAAGAGTGGG + Intronic
987484620 5:18509333-18509355 TTATTGTGCTATAAAATAGTAGG - Intergenic
987492633 5:18599972-18599994 TCAATGGGCCATCAAACTGTGGG - Intergenic
987516759 5:18920045-18920067 TCCATAGGCAATGAAAGAGTGGG - Intergenic
988711265 5:33778363-33778385 TCAATGGACCATAAATGTGTGGG - Intronic
989317560 5:40100405-40100427 TGGATTGGATATAAAAGAGTTGG - Intergenic
992351529 5:75933881-75933903 CCAAAGGGCTATGAAAGTGTAGG - Intergenic
993048114 5:82892382-82892404 TCTATGGGCTCTATGAGAGTGGG + Intergenic
993186900 5:84634032-84634054 TAAAAGAGCTATAAAAGACTAGG - Intergenic
994126710 5:96175571-96175593 GCAATGGGCTATAAATTAATTGG + Intergenic
994237800 5:97385035-97385057 TCTATGGAGTATAAAAGATTAGG + Intergenic
994428321 5:99623293-99623315 TTACTGTGCTATCAAAGAGTAGG + Intergenic
997041214 5:130256892-130256914 TGAATTGGCTATAAATGTGTGGG + Intergenic
1002887239 6:1308644-1308666 GAAATGGGCTAGAACAGAGTTGG + Intergenic
1006244180 6:32715850-32715872 ACAATGGGCCCTAAAACAGTGGG - Intergenic
1006709967 6:36059878-36059900 TGCATGGGCGATAAAAGAGGAGG - Intronic
1008532681 6:52478691-52478713 TCATGGTGCTTTAAAAGAGTTGG + Intronic
1008906867 6:56687427-56687449 TCACAGGGCTAGAAAATAGTGGG - Intronic
1010538360 6:77060104-77060126 TCAATGTGCGATAACAGAGTAGG - Intergenic
1012197348 6:96360239-96360261 TGAATGGGATATTAAGGAGTGGG - Intergenic
1017979812 6:159390945-159390967 TAAATGGCCTATAAAAGGGGAGG + Intergenic
1018540872 6:164877915-164877937 CCAATGGGCAATGAAAGGGTTGG - Intergenic
1022314178 7:29229131-29229153 TCAATGTGCTTTGCAAGAGTGGG + Intronic
1024203262 7:47127469-47127491 TCAATGGGTTATAGAAGAGGTGG - Intergenic
1026591991 7:71704711-71704733 TCAATGGACTATAAATGTGAGGG - Intronic
1026961003 7:74407230-74407252 TCAAAGAGTTAAAAAAGAGTTGG - Intergenic
1032733225 7:134665152-134665174 TCATTGGCCTAGAAAACAGTGGG + Intronic
1033434521 7:141320996-141321018 ACAATGGACTCTTAAAGAGTAGG - Intronic
1033781690 7:144678113-144678135 CTAATGGGCTGTAAAAGATTAGG - Intronic
1036787617 8:11698390-11698412 TCAATGGGAAATGAATGAGTGGG + Intronic
1037258776 8:16983957-16983979 TGAATGACATATAAAAGAGTTGG + Intergenic
1038648064 8:29377724-29377746 TCAATGGGTGATAGAAGGGTAGG + Intergenic
1042945812 8:74153481-74153503 TTAATGGGCTGTAGAACAGTTGG + Intergenic
1043581931 8:81724364-81724386 TCACTGGGCTAGAAAAGACTTGG - Intronic
1044859314 8:96507045-96507067 TCAAAGAGGTATAAAAGTGTTGG + Intronic
1045145908 8:99344151-99344173 TCAATTGACTATAAATGAGTGGG - Intronic
1046740036 8:117818221-117818243 TCACAAAGCTATAAAAGAGTTGG + Intronic
1046884862 8:119354996-119355018 TTAATGGGATGTGAAAGAGTTGG - Intergenic
1048813180 8:138306986-138307008 TCGATGGACGATAAGAGAGTGGG - Intronic
1050207185 9:3209385-3209407 TCAATGGCCTATAAATGTGTAGG + Intergenic
1051063028 9:13067381-13067403 TCAATGGACTATATGTGAGTGGG - Intergenic
1051543707 9:18250422-18250444 TCAATGGGGAATAAAGAAGTAGG + Intergenic
1058273700 9:103009633-103009655 CCAATGTGCTATCAAATAGTAGG + Intronic
1059312031 9:113395193-113395215 TCCTTGGGCTAGAAAAGATTTGG - Intronic
1061567283 9:131450014-131450036 TCAATTGACTATAAAAGCATTGG + Intronic
1186593875 X:10960031-10960053 ACTATGGGCTACAAAATAGTAGG - Intergenic
1187454961 X:19433090-19433112 GCATTGGGGTATAAAAGAGTGGG + Intronic
1187775087 X:22747424-22747446 TAAATGGACCAGAAAAGAGTGGG - Intergenic
1188704299 X:33306851-33306873 TCAATGTGCTCTCAAATAGTTGG + Intronic
1195426883 X:104743673-104743695 TCATTGGGCTTGAAAATAGTGGG + Intronic
1196657059 X:118229277-118229299 CTATTGGCCTATAAAAGAGTTGG - Intergenic
1198718136 X:139584473-139584495 CCAGTGGGCTATTAAAGAGGAGG - Intronic
1199028142 X:142963459-142963481 TGAATGGGATCTAAAAGAGAAGG - Intergenic
1199150605 X:144480903-144480925 TCAAAGGTCAATAAAAAAGTAGG - Intergenic
1199497902 X:148473869-148473891 TCAATGACCCATAAAAGAGAGGG - Intergenic
1201752324 Y:17446561-17446583 ACACTGGTCTATTAAAGAGTGGG - Intergenic