ID: 1138043975

View in Genome Browser
Species Human (GRCh38)
Location 16:53702441-53702463
Sequence AGGCATTGCAGCATTGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 144}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138043975 Original CRISPR AGGCATTGCAGCATTGTGCA GGG (reversed) Intronic
905259224 1:36705843-36705865 AGGCCTTGCAGCACACTGCAGGG + Intergenic
905807498 1:40887407-40887429 AGCCATTGCAGGTTTGGGCAGGG + Intergenic
906063021 1:42960585-42960607 AGGAATTGAAGCCTTGGGCAGGG - Intergenic
907595278 1:55713802-55713824 AAGCATTTCAGGCTTGTGCAAGG - Intergenic
912455080 1:109791810-109791832 TGGCCTTGCAGCAGTGAGCAGGG - Intergenic
916852022 1:168713495-168713517 AGGCATTTCTGCCTTGGGCAAGG - Intronic
916920272 1:169459426-169459448 AGGGATTCCAGCATTGAGCCAGG - Intronic
917895752 1:179485110-179485132 TGGCAGTGCAGCATGTTGCAGGG - Intronic
918286784 1:183064137-183064159 TGGCATTGGAGCATGGTACAGGG + Intronic
920444115 1:206002740-206002762 TGGCATTGCAGCACTGGGCAAGG + Intronic
921283836 1:213591526-213591548 TGGCACTGCAGCCTTGTGCCAGG + Intergenic
921507329 1:215988469-215988491 ATGCATTGCAGCATTATTCACGG - Intronic
921527338 1:216233928-216233950 ATTCTTTGCAGCATTTTGCACGG - Intronic
922930701 1:229386985-229387007 AAGCATTGCAGCCTCTTGCAAGG + Intergenic
924684740 1:246277314-246277336 AGCCATTGTAACAGTGTGCAAGG - Intronic
1062922606 10:1291532-1291554 AAATATTGCAGGATTGTGCAGGG - Intronic
1065776379 10:29124200-29124222 AGGCATTGGGGCACTGTGCCTGG - Intergenic
1068255733 10:54508291-54508313 AGGCATTGCAGCATGGTTAAGGG + Intronic
1068437121 10:57006872-57006894 AGGCATTGCTGAATTGACCATGG - Intergenic
1074234147 10:111567997-111568019 AGGCATTGAATCATTCTGCCAGG + Intergenic
1076342595 10:129759888-129759910 AGGCCTTGCAGCATGGGACAAGG + Intronic
1077422316 11:2458612-2458634 AGGCAAGGAAGCATTGTGGATGG - Intronic
1078178111 11:8985894-8985916 AGGCATTGCAGGATTCTACCAGG - Intronic
1079028028 11:16964253-16964275 GTGCATTGCAGCATTATTCATGG - Intronic
1080971781 11:37286315-37286337 AGGCATTGCATCCTAGTGCCTGG - Intergenic
1081249124 11:40807653-40807675 AGGCATTGCAGTTTTCTGCACGG + Intronic
1083718878 11:64594162-64594184 AGGCATGGCAGCACTGAGCTAGG + Intronic
1083975910 11:66119917-66119939 AGACATTGCTGCATGGTGGAAGG + Intronic
1084650787 11:70488113-70488135 TGGCATTGTGGCATTGTGCTTGG + Intronic
1089166029 11:116477222-116477244 AGGCATTGAAGCTTTGGGGAGGG + Intergenic
1090279541 11:125444215-125444237 AGGCATTGCAGCAGTTTTCCTGG + Intergenic
1095656693 12:44678403-44678425 AGGCATATCAGCATTTAGCATGG + Intronic
1096339399 12:50784731-50784753 AGGCATTACAGTAATGTACATGG + Intronic
1097378065 12:58861540-58861562 AGACATTGGAGCAGTCTGCAGGG - Intergenic
1100480319 12:94971656-94971678 AGGCAGTACAGCATAGTGGAAGG + Intronic
1103687069 12:122740593-122740615 AGGCATTGGAGTGTTGCGCAAGG - Intergenic
1103933738 12:124464280-124464302 AGGCACTGCAGCAATGTGCTGGG + Intronic
1104079630 12:125418622-125418644 AGAGATTACAGCATTTTGCAGGG - Intronic
1108335141 13:49432925-49432947 TGGCATTGAAGCTTTGTGTAAGG - Intronic
1108821462 13:54355828-54355850 AGGCATTAAAGAAGTGTGCAGGG + Intergenic
1108961407 13:56236519-56236541 ATTCATTGCAGCATTGTGCTGGG + Intergenic
1110271381 13:73595043-73595065 AGGCATTACAGCATAATGGAGGG - Intergenic
1114562840 14:23605564-23605586 AGGGTTGGCAGAATTGTGCAGGG - Intergenic
1119930948 14:78546017-78546039 ATTTATTGCAACATTGTGCATGG - Intronic
1120349393 14:83333568-83333590 AGAAATAGCAGCATTGTGGATGG - Intergenic
1120957318 14:90094138-90094160 TGGCATGCCAGCCTTGTGCAAGG - Intronic
1121532333 14:94664203-94664225 AGGCATTGCATCAATGTGGCAGG - Intergenic
1122857060 14:104565061-104565083 AGGCATTGCTGCCCTGTGCAGGG - Intronic
1124686659 15:31788706-31788728 AAACATTGCAGCAATGTGAATGG + Intronic
1125609033 15:40958517-40958539 AGGGATTGCAGAATTGTTTAGGG + Intergenic
1132073732 15:98801677-98801699 AGGCATTGTAGCTATGTGTATGG + Intronic
1133599701 16:7327069-7327091 AGTCATTTCAGCATTGTGTTTGG - Intronic
1134163753 16:11914802-11914824 ATGCATTGCAGCCTTGTGATCGG - Intronic
1138043975 16:53702441-53702463 AGGCATTGCAGCATTGTGCAGGG - Intronic
1138123227 16:54417363-54417385 AGCAATTGCAGCATTTTTCAAGG + Intergenic
1142477511 17:198183-198205 AGGCACAGCAGCCTTCTGCAGGG + Intergenic
1144311240 17:14016088-14016110 AGGAATTGCAGCCCTTTGCAAGG - Intergenic
1147280862 17:39359670-39359692 AGACATTGCTGCATTGCTCATGG + Intronic
1149661953 17:58338588-58338610 AGGGACAGCAGCGTTGTGCAAGG + Intergenic
1152722629 17:81930304-81930326 AGGCGTGGCAGAATTGGGCAGGG + Intergenic
1154037993 18:10825193-10825215 ATGTAATGCAGCATTCTGCATGG - Intronic
1156095475 18:33526268-33526290 TGGCATTGCAGCAATTTGGATGG - Intergenic
1156257170 18:35409556-35409578 AGGCACTGCAGGATTTTGAAAGG + Intergenic
1156787672 18:40935126-40935148 AGTGATAGCAGCATTGGGCATGG + Intergenic
1158544532 18:58384832-58384854 AGGCATTCCATCATTCTGAAGGG - Intronic
1158823158 18:61184490-61184512 AGCCTTTTCAGCATTGTGCAAGG + Intergenic
1159643893 18:70894618-70894640 GGTCATTGCTGCATTTTGCATGG + Intergenic
1161671590 19:5614621-5614643 AGGCATTGCAGCTTTCAGCTTGG - Intronic
1164170689 19:22722528-22722550 AGGCATTGCAACATACTGCTGGG - Intergenic
1165480476 19:36060579-36060601 AGGCCTTGCAGCCTTGTAGAGGG + Intronic
925587920 2:5481948-5481970 AGGCATTGGAGCAGGGTGCATGG + Intergenic
927711423 2:25328679-25328701 AGGCACCGCAGCACTGTGCTGGG - Intronic
928436287 2:31256730-31256752 AGGGATTGCAGCAAGTTGCAGGG + Intronic
928594061 2:32843827-32843849 ATGCATTTCAGCATTCTGCTTGG - Intergenic
932933121 2:76066287-76066309 AGGCATTTCTGCATTGAGCCAGG - Intergenic
937216325 2:120315839-120315861 GGGCATTTCAGCACTGTGCCGGG - Intergenic
938090533 2:128429195-128429217 AGACACTGTGGCATTGTGCAGGG - Intergenic
941003387 2:160223459-160223481 AGCCATTGCAGGTTTGTTCACGG + Intronic
943119387 2:183715503-183715525 AGGCAATGTAGAAATGTGCAAGG - Intergenic
944175776 2:196827533-196827555 AGGAAATACAGCATTGTACATGG - Intergenic
944918601 2:204387272-204387294 AGGCATTGCAGGATTGGAAAAGG - Intergenic
945019364 2:205555879-205555901 AGGCATTGCACCCTGGTCCATGG + Intronic
947028795 2:225769131-225769153 AGGCTCTGCAGCACTGTACAAGG - Intergenic
947809079 2:232988701-232988723 ACTCATGGCAGCATTGTTCAAGG + Intronic
1168860783 20:1044636-1044658 AGGGGATGCAGCATGGTGCAGGG - Intergenic
1169620622 20:7502854-7502876 AGACATTGCCGCTTTGTGGAGGG - Intergenic
1175154606 20:56961879-56961901 AGGCATTGCAGCATTGTTTTTGG - Intergenic
1181816135 22:25438030-25438052 AGGCCCAGCAGCGTTGTGCAGGG + Intergenic
949173859 3:1034858-1034880 TGGCTTTGCAGCACTGTGCTGGG + Intergenic
949767719 3:7545518-7545540 AGCCACTACTGCATTGTGCAAGG - Intronic
954115862 3:48466509-48466531 AGACAGGGCAGGATTGTGCAGGG + Intronic
955807862 3:62755933-62755955 AGGCAATGGAGCATTGTGGCAGG + Intronic
962960113 3:140303322-140303344 GTGCATTCCAGCATTGTGCCAGG - Intronic
963292487 3:143506013-143506035 AGTCATTGCAGGATTTTGTAAGG + Intronic
965240480 3:166190583-166190605 AGACAATGCAGCGTTGTCCAGGG - Intergenic
966699536 3:182832004-182832026 AGGTATTGCAACATTTTACATGG - Intronic
968500241 4:946539-946561 AGCCATTGCTGCATGGTGCTGGG - Intronic
969416209 4:7061188-7061210 AGGCATTCAAGCCTTCTGCAAGG - Exonic
970264948 4:14271927-14271949 AGACATGGCAGCTGTGTGCAGGG - Intergenic
970280481 4:14449451-14449473 AGGCTTGGCAGCCTTGTGCTGGG + Intergenic
970702112 4:18754325-18754347 AGGCATTTCAGCCCTGTGCCAGG - Intergenic
971587631 4:28424668-28424690 GTGCATTGCAGCACTGTTCATGG + Intergenic
972840417 4:42923639-42923661 AGGCATAGAAGCATGGGGCAAGG - Intronic
975984313 4:80188933-80188955 TGGCACTGGAGCTTTGTGCAGGG - Intronic
977873766 4:102125015-102125037 AGCCCTTTCAGCAATGTGCAAGG - Intergenic
981421578 4:144556221-144556243 AGGCATTTCAGCATTTATCATGG - Intergenic
982305455 4:153925791-153925813 AGGCTTTGCGGGAGTGTGCAGGG + Intergenic
982669429 4:158302319-158302341 AGGCATTGCAGCATATTTTATGG + Intergenic
984547059 4:181118979-181119001 AGGGATTTCAGCTTTGTGCAGGG + Intergenic
985215368 4:187647476-187647498 AGTCATAGCAGCATTATTCATGG + Intergenic
986174704 5:5341822-5341844 AGGCATTCCAGCACTCTCCAGGG - Intergenic
989018478 5:36969976-36969998 ATACATTGCAGCATTGTTTATGG + Intronic
989415847 5:41174568-41174590 TGGCATTGCTTCAGTGTGCAAGG - Intronic
989484819 5:41977165-41977187 AGGCATTGCAGAAGTCTTCAAGG - Intergenic
990866544 5:60386599-60386621 AGCCAGTGCAGCATTGGGCAGGG + Intronic
991296731 5:65089453-65089475 AGACATTTCAGCATTCTTCATGG - Intergenic
993254208 5:85566670-85566692 ACACATTGCAGAACTGTGCATGG - Intergenic
999013246 5:148067089-148067111 AAGCACTGCAGCAATCTGCAAGG + Intronic
1000603713 5:163304970-163304992 AGGCATTGCATTATTCTGAAGGG - Intergenic
1002258608 5:177978376-177978398 AGGCATTTGAGCATGGTGGAAGG + Intergenic
1002329540 5:178432141-178432163 AATCATTGCAGCATTCTTCAAGG + Intronic
1002501253 5:179649170-179649192 AGGCATTTGAGCATGGTGGAAGG - Intergenic
1003199563 6:3946765-3946787 AGCCACTGCAGCATTCTGGAAGG - Intergenic
1007159528 6:39777799-39777821 AGGTTTAGCAGAATTGTGCAAGG + Intergenic
1010629579 6:78182059-78182081 AGGTATTGCAGGTTTGTGGAGGG + Intergenic
1011097735 6:83684832-83684854 AGTCATTGCAGCATGGTTCTAGG - Intronic
1012305873 6:97656444-97656466 AGTCTTTGGAGCATTGTTCAGGG + Intergenic
1016981073 6:149854740-149854762 GTGCCTTGCAGCACTGTGCAGGG - Intronic
1017232444 6:152087703-152087725 AGTCATTGTAGCATTGTGATAGG + Intronic
1017449211 6:154538139-154538161 AGGCATTACAACATAGTCCAAGG + Intergenic
1017936434 6:159009743-159009765 AGGGATGGCAGCATTGTGGGTGG + Intergenic
1032232464 7:130087137-130087159 GGGGAGTGCAGCATGGTGCAGGG - Intronic
1032497643 7:132374840-132374862 AAGCATTCCAGCTTTCTGCAGGG + Intronic
1032840656 7:135711035-135711057 AGGCACTGCAGGATTGTCCTAGG + Intronic
1034401979 7:150868389-150868411 AGGTTTTGGAGCAGTGTGCAAGG - Intergenic
1035897234 8:3416714-3416736 AGGCAAGGCAGCACTGTACATGG + Intronic
1037449549 8:19003168-19003190 AGGCAGTGCAGCATAGTGGTTGG - Intronic
1037584239 8:20265533-20265555 AGGCATTGTGGCACTGTGCCTGG - Intronic
1038150419 8:24938429-24938451 AGGCAGTGCTGCCTAGTGCAGGG + Intergenic
1038504987 8:28076440-28076462 AGGCATTGCACCATCATGCCTGG + Intronic
1038792521 8:30680836-30680858 AGGGATGGCAGTATTTTGCAGGG - Intronic
1040288295 8:46111527-46111549 AGGCTTTGGAGCAGTGTGCCGGG - Intergenic
1040784523 8:51149730-51149752 AGGAAATGCAGCATTTTACATGG + Intergenic
1041248995 8:55916740-55916762 TGCCATTGCAGTATTGGGCATGG - Intronic
1045760516 8:105601160-105601182 AAGCCTTGCAGTATGGTGCAGGG - Intronic
1046723559 8:117650419-117650441 AGACATTGCAGAAATGAGCAAGG - Intergenic
1047482473 8:125297980-125298002 AGGCATTGCACCACTGTGCCTGG - Intronic
1051211358 9:14748251-14748273 AGGCACTGCATAACTGTGCAAGG + Intronic
1052629646 9:31020819-31020841 GGGCAATGCACCATTGGGCATGG - Intergenic
1057394111 9:94664263-94664285 AGGCACTGGAGCATTATACAAGG + Intergenic
1057916364 9:99058566-99058588 ATGCCTTGCTGCATTGAGCAAGG + Intronic
1058704533 9:107627684-107627706 TGGCATTCCAGCATTGTGCCAGG - Intergenic
1061643193 9:131976325-131976347 CAGCATTGCAGCATTTTGCTGGG - Intronic
1061956778 9:133967570-133967592 TGTCATTGCAGCAATGTGGATGG + Intronic
1186380668 X:9055247-9055269 AGGCAGCGCAGCATTCTGCAGGG + Intronic
1189890904 X:45601190-45601212 AATGCTTGCAGCATTGTGCAAGG + Intergenic
1193502548 X:82297598-82297620 AGGCTCTCCAGCATTGGGCATGG - Intergenic
1193891422 X:87050452-87050474 ATGCTTTTCAGCCTTGTGCAGGG + Intergenic
1197150665 X:123217047-123217069 AGGCACTGCAGAAATGTCCATGG - Intronic
1202049764 Y:20768280-20768302 AGGAAGAGCAGCATTGTGTATGG + Intronic