ID: 1138044357

View in Genome Browser
Species Human (GRCh38)
Location 16:53705312-53705334
Sequence CAGATCATGCAGGATCTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 724
Summary {0: 1, 1: 2, 2: 23, 3: 147, 4: 551}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138044357_1138044362 6 Left 1138044357 16:53705312-53705334 CCTACAAGATCCTGCATGATCTG 0: 1
1: 2
2: 23
3: 147
4: 551
Right 1138044362 16:53705341-53705363 ACCTGCTTTCACAACCCCATTGG 0: 1
1: 0
2: 0
3: 16
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138044357 Original CRISPR CAGATCATGCAGGATCTTGT AGG (reversed) Intronic
900612259 1:3549131-3549153 CAGACCATGCAAGCTCTGGTGGG + Intronic
900828559 1:4947176-4947198 CAAATCTTGCAGGAGCTTCTTGG + Intergenic
902045243 1:13519116-13519138 CAGGCCATGCAGGATCTGGTGGG - Intergenic
902408565 1:16199760-16199782 CAGACCATGAAGGGCCTTGTAGG - Intronic
903087286 1:20873138-20873160 CAAATCATGTAGTATCTTTTTGG + Intronic
903272994 1:22203422-22203444 GCAAGCATGCAGGATCTTGTGGG + Intergenic
903690688 1:25171348-25171370 CGGACCATGCAGGATCTTGTAGG - Intergenic
904053485 1:27655362-27655384 TAGATCACGCAGGGCCTTGTAGG + Intergenic
904146870 1:28400047-28400069 CAGGACATGTAGGATCTTATAGG + Intronic
904715220 1:32462860-32462882 CAGATTATGTAGGAATTTGTAGG - Intergenic
904776604 1:32912322-32912344 CAGAGCATGCTGGAAATTGTGGG - Intergenic
904942108 1:34171131-34171153 CAGATGATGGGGGCTCTTGTAGG - Intronic
905071621 1:35230813-35230835 CAGATCATGAATGGTCTTGAAGG + Intergenic
905126103 1:35717296-35717318 CAGATCAAACAGGGTGTTGTAGG - Intronic
905322804 1:37129763-37129785 CACATCATGCAAGATCTTAGAGG + Intergenic
905546876 1:38807207-38807229 CAGATCAGGAAGGGTCTTGTGGG + Intergenic
905654396 1:39676783-39676805 CCGATCATGCAGGACCTGGAGGG + Intergenic
905843310 1:41204438-41204460 CAGATCATGCAGGACTATGTGGG - Intronic
906096556 1:43228147-43228169 TGGATCACGCAGGACCTTGTGGG - Intronic
906179686 1:43807474-43807496 CAGGTCTTGGGGGATCTTGTAGG + Intronic
906739083 1:48163472-48163494 GAGATAATGCAGGATATTGAAGG + Intergenic
906824068 1:48959864-48959886 CAGATCATGTAGGGCCTTGTAGG + Intronic
907021249 1:51068599-51068621 CAGATCATGAAGGGTCTTGTGGG - Intergenic
907077249 1:51590073-51590095 TAGATCATGGAAGCTCTTGTGGG + Intronic
907530221 1:55088037-55088059 CAGATCAAGCAAGGCCTTGTGGG + Intronic
907587729 1:55636045-55636067 CAGGTCATGCTGGATCCTGGAGG + Intergenic
907638346 1:56159100-56159122 CAGATCATGCAGGGATCTGTAGG + Intergenic
907924764 1:58944832-58944854 TAGATCATCCAGGACCTTATGGG + Intergenic
907952162 1:59194151-59194173 CAGAGCATGCATGACCTTGTTGG - Intergenic
908647065 1:66289610-66289632 CAGGTCTCGCAGGATCTTGTAGG + Intronic
909604441 1:77494409-77494431 CAGATGCTGCAGGATCTAGCAGG + Intronic
910624059 1:89287537-89287559 CAGATCGTGTAGAATCTTGCAGG - Intergenic
910820937 1:91345420-91345442 GATATCAAGCAGGATTTTGTGGG + Intronic
910902319 1:92134354-92134376 CAGATCATGGAGGGTCTTGCAGG - Intronic
910967293 1:92820281-92820303 CAGAGCATGTAGGATTTTGTGGG + Intergenic
911412611 1:97528956-97528978 CATATCATGAAAGAGCTTGTAGG - Intronic
912347361 1:108976902-108976924 CAAATCAAGCAGGCTCCTGTAGG + Intronic
912698478 1:111858748-111858770 CAGATCATGGAAGGCCTTGTAGG - Intronic
912884688 1:113458028-113458050 CAGGTCACGTAGGAACTTGTGGG + Intronic
913286902 1:117234880-117234902 TAGATCATGTAGGGCCTTGTGGG + Intergenic
915113312 1:153578647-153578669 CAAATCATGCAGAGCCTTGTAGG + Intergenic
915900337 1:159842119-159842141 CAGATCATGCAGGGTCTGATAGG + Intronic
915923991 1:160002365-160002387 CAGATCCTGCAGGGTCTTGTAGG - Intergenic
916036858 1:160929878-160929900 CAGATTGTGTAGGATATTGTGGG - Intergenic
916366926 1:164039711-164039733 CAAATGATGCAGGATCTTGCAGG - Intergenic
916984574 1:170176979-170177001 AAGATTATGTAGGATCTTGTAGG + Intergenic
918327211 1:183421320-183421342 CAGATCATACAGGGCCTTGTAGG + Intergenic
919733753 1:200931316-200931338 CAGATCATGAAGGGTCTTGTGGG - Intergenic
919947426 1:202329851-202329873 CAGATCATGCGGGGTCTTATGGG + Intergenic
920036172 1:203067280-203067302 CAGATCATGGAGTATCTTATAGG + Intronic
921324027 1:213972953-213972975 CAGATTATCCAAAATCTTGTAGG + Intergenic
921757238 1:218872900-218872922 CAGAGTGTGCAGGATCTTGCAGG + Intergenic
921813807 1:219544466-219544488 CAGACCATAAAGGACCTTGTAGG + Intergenic
922224082 1:223630198-223630220 CAGATCATGAATGACTTTGTTGG - Intronic
922429080 1:225529220-225529242 CAGATCATGCAGGACCTTGCAGG - Intronic
923403237 1:233636139-233636161 CAGATCATGTAGGACCTTATGGG + Intronic
923543624 1:234908099-234908121 CAAATAATGCAGGATCTTTATGG + Intergenic
924003283 1:239577789-239577811 CAGACCATGCATTATCTTGAAGG + Intronic
924189375 1:241534053-241534075 CAGATCTTGTAGGATCTTAGAGG + Intronic
924200193 1:241650500-241650522 CAGATCACGTAGGATCTTATTGG - Intronic
924645687 1:245875372-245875394 CAGAACATGCTGGAAATTGTGGG + Intronic
924721502 1:246627274-246627296 AAGATCATGTAGGGCCTTGTAGG - Intronic
1065255486 10:23862728-23862750 CAGATCACAGAGGATCTTGTAGG + Intronic
1065926884 10:30442574-30442596 CAGATCTTGCTGGATGTTGGTGG - Intronic
1066123263 10:32312181-32312203 CAGATCATGCAGAGTCTTAGGGG + Intronic
1067508070 10:46873209-46873231 CAGATGCTGCAGGCTCTTCTGGG + Intergenic
1067654179 10:48178636-48178658 CAGATGCTGCAGGCTCTTCTGGG - Intronic
1070112900 10:73501675-73501697 CATATCACACAGGACCTTGTAGG - Intronic
1071372527 10:84966858-84966880 CCACTCAGGCAGGATCTTGTGGG - Intergenic
1071455682 10:85849840-85849862 CTGGTCAAGCAGGATCTTGCTGG - Intronic
1071757866 10:88565442-88565464 CAGATGTTAAAGGATCTTGTGGG + Intronic
1071986950 10:91061535-91061557 CAGATCATGGGGGACCTTGTAGG - Intergenic
1075462524 10:122627018-122627040 CAGATCATTCAGGGCCTTGTGGG + Intronic
1075597966 10:123746114-123746136 GAGATCATTCAGGAGTTTGTTGG - Exonic
1075881230 10:125853014-125853036 CAAATCAACCAGGATCTTGGTGG + Intronic
1076297459 10:129397664-129397686 CGGATCCTGCAGGACTTTGTGGG - Intergenic
1076631597 10:131855309-131855331 CAGAACATGAAGGATTTTGGTGG - Intergenic
1077609130 11:3633514-3633536 CACCTCATGCAAGAGCTTGTAGG - Intergenic
1077900825 11:6486984-6487006 TGGATCATGCAGGGCCTTGTAGG - Intronic
1077906917 11:6541625-6541647 CAGATCATGCAAAGTCTTGTGGG + Intronic
1078579413 11:12527016-12527038 CAGAGCTTGCATGATTTTGTAGG - Intronic
1078674939 11:13401791-13401813 CAGAAGATGCAGGGTCTTATAGG - Intronic
1078846744 11:15125329-15125351 CAGCTCATGAAGGCTCTTGTGGG + Intronic
1079097910 11:17522801-17522823 CTGCTCCTGGAGGATCTTGTTGG + Exonic
1079532685 11:21474087-21474109 CAGATTATGCAGAATCTCATAGG - Intronic
1079619970 11:22542025-22542047 CAGATCATGCAATGCCTTGTGGG + Intergenic
1080373176 11:31676063-31676085 CAGGTCATGTAGGGTCTTGGTGG - Intronic
1080504654 11:32900590-32900612 TAGATCATGCAGGGCTTTGTAGG - Intronic
1080559329 11:33448124-33448146 CAGAACATGCAGGTTTATGTGGG + Intergenic
1080580369 11:33637445-33637467 CAGATCATGCAGGGTCTTAAAGG - Intronic
1080584977 11:33673794-33673816 CAGATGAGGCTAGATCTTGTGGG - Exonic
1080935856 11:36862672-36862694 CAGATCATATAGGATCTTTTGGG - Intergenic
1081264887 11:41008322-41008344 CAGATAATGTAGGGTTTTGTAGG - Intronic
1081470811 11:43368800-43368822 TAGATCTTACAGGACCTTGTAGG - Intronic
1081729768 11:45362222-45362244 TAGATCATGTAGGGTCTTTTGGG - Intergenic
1081925050 11:46819387-46819409 CAGATCATGCAGGACTATGAAGG + Intronic
1082130868 11:48487820-48487842 CAGGTCATCTAGGGTCTTGTAGG + Intergenic
1082564367 11:54658693-54658715 CAGGTCATCTAGGGTCTTGTAGG + Intergenic
1082773124 11:57224242-57224264 CAGGTCATGTAGGACCTTGAAGG - Intergenic
1082839139 11:57674461-57674483 CAGAGCATGCTGGATCTTCTGGG + Intronic
1083968257 11:66056462-66056484 CAGATTGTGCTGGATCTTGAGGG + Intronic
1084887013 11:72217338-72217360 AAGATCATGCTGGCTCCTGTGGG + Intronic
1084977538 11:72810860-72810882 CAGATCAAGCAGGGCCTTGAAGG + Intergenic
1086116913 11:83261573-83261595 TAAATCATACAGGATTTTGTGGG - Exonic
1086231250 11:84572624-84572646 AAGAACATGCAGAATCTTTTAGG - Intronic
1086576670 11:88346631-88346653 CCAATGATGCAGGGTCTTGTGGG - Intergenic
1086633367 11:89051381-89051403 CAGGCCATGCAGGATGTTGCAGG + Intronic
1086884772 11:92192634-92192656 CAGATCATAAAGGATCTTTTAGG - Intergenic
1086885481 11:92200629-92200651 CAGATCATGCAGGACTGTTTGGG + Intergenic
1086980735 11:93195664-93195686 CAAATTATGTAGGGTCTTGTAGG - Intronic
1088280055 11:108126432-108126454 CAGATCATGCAGGTTCTTGGAGG + Intronic
1088673685 11:112168971-112168993 CAGATAATACAGGACCTTGAAGG + Intronic
1088904470 11:114143823-114143845 CATAGCATGCAGTATGTTGTTGG + Intronic
1089015327 11:115160775-115160797 CAGATTATGGAGGATTTTATGGG - Intergenic
1089206713 11:116770312-116770334 TGGACCATGCAGGATCCTGTAGG - Intronic
1091203308 11:133799574-133799596 CAGATTTTGAAGGATCTTGAAGG + Intergenic
1091427790 12:406502-406524 CAGATCATACAGGACCTTGTCGG + Intronic
1092391985 12:8088720-8088742 CAGATCACGCAGGGCCTTGTGGG - Intronic
1092737353 12:11595093-11595115 CCGATCATGCAGGACATTGTAGG - Intergenic
1093069461 12:14693421-14693443 AAGAACATTCAGGATCTAGTGGG - Intronic
1093547405 12:20365379-20365401 AAGATCATGAAGGTCCTTGTAGG + Intergenic
1094055506 12:26265432-26265454 TAGATCATGAAGGACCTTGCAGG + Intronic
1094141763 12:27188852-27188874 CACATCTTGCAGGGACTTGTAGG - Intergenic
1094342861 12:29432164-29432186 CAGATCCTATAGCATCTTGTAGG + Intronic
1095282177 12:40366092-40366114 CAGCTCATGCAGCACCTTGTAGG - Intronic
1095730446 12:45500971-45500993 CAGATCATTTAGGAACTTCTAGG + Intergenic
1096201734 12:49688410-49688432 CAGATTATGTGGGACCTTGTTGG - Intronic
1097159035 12:57032753-57032775 CAGATCATGATGGGCCTTGTAGG + Intronic
1097682111 12:62658572-62658594 CAAATCATGTAGGATCTTTAGGG + Intronic
1097962317 12:65544862-65544884 CAGATCATGAAGGGACTTCTAGG - Intergenic
1097974176 12:65666935-65666957 AAGAGCTTGCAGGATCGTGTGGG - Intergenic
1098641938 12:72849525-72849547 CAGATAATACAGGACCTTGTAGG + Intergenic
1099203363 12:79700875-79700897 CAGATCATACAGGGTCTTAAAGG - Intergenic
1099210901 12:79787267-79787289 CAGATCATGCAGTGCCTTATAGG - Intronic
1099372647 12:81856320-81856342 CTGATCATACAGGAACTTGTAGG + Intergenic
1099496889 12:83359310-83359332 CAGATCATGTAGGATGTTGTAGG + Intergenic
1099849071 12:88069102-88069124 CAAACCATGGAGGGTCTTGTAGG - Intronic
1100016070 12:90012263-90012285 TAAATCATCCAGGACCTTGTTGG - Intergenic
1100209342 12:92385459-92385481 CAGATCCTACAGGATCCTGCAGG - Intergenic
1101451762 12:104786174-104786196 GAGATTATGAAGGACCTTGTTGG + Intergenic
1101752421 12:107593341-107593363 CCCATCATGGAGCATCTTGTGGG + Intronic
1102596584 12:113997385-113997407 CAGATCATGCAGGGACATGCAGG + Intergenic
1103085020 12:118056165-118056187 CAGATTATGCTGGATTTTGAGGG - Intronic
1103172597 12:118834282-118834304 CAGATCATGCAGGGACATGTTGG + Intergenic
1103255813 12:119540524-119540546 CAAATCTTCCAGGATCTTGAGGG + Intronic
1103761666 12:123254545-123254567 GAGATCATGGAGGATCATGGAGG + Intronic
1103813545 12:123634818-123634840 CAGGTCATGCAGGGCCTTATTGG + Intronic
1103856835 12:123976487-123976509 CAGATCAAGTAGGGTCATGTAGG + Intronic
1104072345 12:125356703-125356725 CAGACCACGCAGGGCCTTGTAGG - Intronic
1104411305 12:128560320-128560342 CAGATCACTCAGGATCTTGCAGG - Intronic
1104697903 12:130878500-130878522 CAGAGCCTGCAAGACCTTGTAGG - Intergenic
1106167459 13:27261472-27261494 CAGATAATGTAGGGTTTTGTAGG - Intergenic
1106310082 13:28546444-28546466 TAGATCATGCAGAACCTTGTAGG + Intergenic
1106317019 13:28603320-28603342 GAGAACATGGAGGATCTTGCAGG - Intergenic
1106446374 13:29835923-29835945 TAGATCATGCAGGACCCTGAAGG + Intronic
1106614985 13:31318434-31318456 GAGATCCTGCAGGTTCCTGTAGG - Intronic
1107001918 13:35557482-35557504 CAGAGCATGCAGACTCTGGTGGG + Intronic
1107438765 13:40405011-40405033 CAGATCATGTAGCATCCTATTGG - Intergenic
1108161549 13:47645463-47645485 CAGATCATGCAGGGCCCTGTAGG - Intergenic
1108994973 13:56718723-56718745 CAGATCATATATGACCTTGTAGG + Intergenic
1109030923 13:57186125-57186147 CAGATCATGACAGAACTTGTAGG - Intergenic
1110064765 13:71089386-71089408 CAGATCATGTAGAACCTGGTGGG + Intergenic
1110142264 13:72144978-72145000 CAGCTCCTGCAGGATCATTTTGG - Intergenic
1110145740 13:72188207-72188229 CAGACCATGCAGGGTCTTAAAGG - Intergenic
1110270503 13:73584306-73584328 CATATTATGCAGGATCTTGTAGG + Intergenic
1110559472 13:76895066-76895088 CAGCTCATTCATGATCTTTTTGG + Intergenic
1110639217 13:77802530-77802552 AAGATCATGTAGGAGCTTGTAGG + Intergenic
1110819622 13:79899404-79899426 AAAAAAATGCAGGATCTTGTAGG - Intergenic
1111359220 13:87152895-87152917 TACATCATGCAGGATTTTATGGG - Intergenic
1111698974 13:91661843-91661865 CAGATCATTCAGGGCCCTGTGGG + Intronic
1111908956 13:94288493-94288515 CAGATAATGCAAGAGCTTGCAGG - Intronic
1112393218 13:99003917-99003939 CATATCATGGTGGGTCTTGTTGG - Intronic
1115374367 14:32657120-32657142 CAGATCCTGCATGATCTCCTGGG + Intronic
1115732666 14:36287994-36288016 CAGATCATGTAGGGCCCTGTAGG + Intergenic
1115775164 14:36706993-36707015 CAGATCATACTGGCCCTTGTAGG - Intronic
1115919709 14:38359148-38359170 CAGCTCATTCAGGGTCTTCTAGG + Intergenic
1116785536 14:49284389-49284411 GAGATCAGAGAGGATCTTGTAGG - Intergenic
1117077161 14:52116296-52116318 CAGATGCTACAGGGTCTTGTAGG - Intergenic
1117344616 14:54820033-54820055 CAGGTCATGAAGGGTCTTGTGGG - Intergenic
1117666830 14:58064895-58064917 TAGGTAATGCTGGATCTTGTAGG + Intronic
1117803624 14:59468288-59468310 CAAATCATGCAGTGCCTTGTAGG - Intronic
1117828730 14:59729288-59729310 CAGATCATGTAGGATCTCATGGG + Intronic
1117937138 14:60919245-60919267 CAGATCACTCAGGGTCTTGTGGG + Intronic
1118221238 14:63856195-63856217 CAGATCATGCAGGGCCTTTCTGG + Intronic
1118235950 14:64005120-64005142 TAGCTCATGCAGGAACTTTTAGG + Intronic
1118587054 14:67363692-67363714 CAGATCATATAGGATTCTGTAGG + Intronic
1119142318 14:72278515-72278537 CAAATCATGCAACATATTGTTGG - Intronic
1119557558 14:75565421-75565443 CAAATCTTGCAGGGCCTTGTGGG - Intergenic
1119626468 14:76181154-76181176 CAGATTATGCAGGGTATTGCAGG - Intronic
1119628693 14:76206935-76206957 AAGATCTTTCAGGAGCTTGTAGG - Exonic
1120000427 14:79296890-79296912 CAGATCACGCAGGAACTGCTAGG - Intronic
1120316620 14:82902496-82902518 CAGATCATGCAGTACACTGTAGG - Intergenic
1120352549 14:83381335-83381357 GAGATCATGTAGAATGTTGTAGG + Intergenic
1121898360 14:97670125-97670147 CTGGACATGCAGGATCTTGGTGG + Intergenic
1122440648 14:101729499-101729521 CAGGTCACGTAGGGTCTTGTGGG - Intergenic
1123198358 14:106638775-106638797 TGGGTCATGCAGGAACTTGTAGG + Intergenic
1124324427 15:28745415-28745437 CAGACCGTGCAGGGGCTTGTGGG + Intergenic
1125102745 15:35933822-35933844 CAGATCATCCAGGGCCTTGTTGG + Intergenic
1125212321 15:37231827-37231849 GAGATCATGTAGGGTTTTGTAGG + Intergenic
1125306356 15:38320392-38320414 CAGCTCATGCAGGGCCTAGTAGG + Intronic
1125456398 15:39864131-39864153 CAAATCAGGCAGCATCTGGTAGG - Intronic
1125841612 15:42806502-42806524 CAGATAATGCAGGGCCTTGTAGG - Intronic
1125842531 15:42817723-42817745 CAGATCATGAAAAGTCTTGTAGG - Intronic
1125900629 15:43343337-43343359 CAGATCATGTGGGACCTTGTAGG - Intronic
1126068444 15:44844694-44844716 CTGATTATGGAGGATCTTGAAGG - Intergenic
1126090386 15:45046112-45046134 CTGATTATGGAGGATCTTGAAGG + Intronic
1127222548 15:56895478-56895500 ATGATCATGAAGGATCTTTTGGG + Intronic
1127345054 15:58086447-58086469 CATATCATGCATGACCTTGGTGG + Intronic
1127387430 15:58477907-58477929 CAGATCATAGAGGGACTTGTGGG - Intronic
1128295873 15:66518986-66519008 CAGATCCTGAAGGTACTTGTTGG + Exonic
1128446666 15:67768442-67768464 CAGAGCATGCAGCATTTGGTGGG - Intronic
1128581049 15:68810175-68810197 CAGACCATGCAGCACCTTGTTGG + Intronic
1129624534 15:77182792-77182814 CAGATCATGCAAGGCCTTTTAGG + Intronic
1130318449 15:82817360-82817382 CAGACCATGCAGGGGCTTGTGGG + Intronic
1130705333 15:86227838-86227860 CAGATTCTACAGGATCTTGAGGG + Intronic
1131623843 15:94097060-94097082 CAGAACATTCAGGGCCTTGTAGG + Intergenic
1132828304 16:1915777-1915799 CAGCTCATCCAGGCTCTTGAGGG - Intronic
1134306582 16:13038382-13038404 TAGATTGTGCAGGACCTTGTGGG - Intronic
1134331138 16:13252125-13252147 CAGATCATGGAAGGTCTTTTGGG - Intergenic
1134819910 16:17238627-17238649 CTGGTCATGCAGGACCTTGTAGG - Intronic
1134858164 16:17537796-17537818 CAGATCACCTAGGATCATGTAGG - Intergenic
1136056730 16:27695311-27695333 CAGGTCATGCAGGGCCTTGCAGG - Intronic
1136596421 16:31253254-31253276 CAGGTCATGCAGGTCCTTGTAGG + Intergenic
1137989207 16:53135240-53135262 CAGATTATACAGGGCCTTGTGGG + Intronic
1138044357 16:53705312-53705334 CAGATCATGCAGGATCTTGTAGG - Intronic
1138356336 16:56383970-56383992 CAGAACATGCAGGGTCTTATAGG - Intronic
1138369742 16:56517290-56517312 CAGATCATATAGGAACTTGTAGG - Intronic
1138797255 16:59983940-59983962 CAGATCATAAAGGGTCTTGTAGG + Intergenic
1139607908 16:68033012-68033034 CTGATCATGCAGGGCCTTGTGGG + Intronic
1139608211 16:68035310-68035332 CAGATCATGTAGAGCCTTGTAGG - Intronic
1140101226 16:71919190-71919212 CAGACAATGCAGGACCATGTAGG - Intronic
1140979880 16:80097419-80097441 CAGCTCATATAAGATCTTGTAGG - Intergenic
1143092964 17:4460201-4460223 CAGATCATGTAGGATGTTGTGGG + Intronic
1143347701 17:6262136-6262158 CAGATCTTGGAGGGTCTTGTGGG - Intergenic
1143745628 17:8992054-8992076 CAGAGCCTGCAGTGTCTTGTGGG - Intergenic
1144285044 17:13765975-13765997 CAAGTCATGCAGGATCTTGCGGG + Intergenic
1146791803 17:35755074-35755096 TAGATCATGCAGGGCCTTGTAGG + Intronic
1147218948 17:38917036-38917058 CCGATTATGCAGGGACTTGTGGG + Intronic
1147763277 17:42815175-42815197 CAGTTCCTGAAGGATCTCGTAGG - Intronic
1149002977 17:51775951-51775973 CCAATTGTGCAGGATCTTGTGGG + Intronic
1149451861 17:56755934-56755956 CAAATCATGCAGGAGCTTGGGGG - Intergenic
1149814734 17:59712724-59712746 CAGGTCATGCAGAATTTTGCAGG + Intronic
1150113839 17:62526967-62526989 CAGATCACGCAGGAGCTTTTAGG - Intronic
1151080324 17:71322226-71322248 CAGATCATGTCGAATCTTGAAGG - Intergenic
1151142186 17:72004287-72004309 ATGATCATGCTGGATGTTGTAGG + Intergenic
1151355975 17:73558772-73558794 CCCATCCTCCAGGATCTTGTAGG - Intronic
1153018161 18:602945-602967 AAGGTCTTGCAGGACCTTGTAGG + Intronic
1153165857 18:2261588-2261610 CAGACCATACAGGACTTTGTGGG - Intergenic
1153200602 18:2643684-2643706 AAGATCATGCAGGGCCTTGGAGG - Intergenic
1153445093 18:5162879-5162901 CAGGTCATGGAGCTTCTTGTTGG + Intronic
1153545618 18:6202329-6202351 TTGATTATGCAGGATCTAGTAGG + Intronic
1155134869 18:22980599-22980621 CAGGTCATGTAGGATCTTCATGG + Intronic
1155301238 18:24431414-24431436 CAGATCCTGCAGAGTTTTGTAGG + Intronic
1155337522 18:24780036-24780058 CAGATCACACAGGACCTTGTAGG - Intergenic
1155442937 18:25880976-25880998 CAGATCATGTAGGGTCTAGAGGG + Intergenic
1155833220 18:30544220-30544242 CAGACCATGCAAGGTCTTGTAGG - Intergenic
1156035416 18:32761335-32761357 CAAATCATACAGGAAGTTGTAGG - Intronic
1156410859 18:36827569-36827591 CAGATCTTACAGGGACTTGTGGG + Intronic
1156809684 18:41232408-41232430 CAGATTATGTAGGGCCTTGTGGG - Intergenic
1157899855 18:51504453-51504475 CAGATCATGTAACATCTTGTGGG + Intergenic
1158543437 18:58376787-58376809 CAGGCCACGCAGGACCTTGTGGG - Intronic
1159349013 18:67247316-67247338 CAGATCACGATGGATCTTATAGG + Intergenic
1160940496 19:1618473-1618495 CAGGTCATGCGGGGCCTTGTGGG - Intronic
1161286468 19:3471056-3471078 CAGGTCATTCAGGGCCTTGTGGG + Intergenic
1161605645 19:5213344-5213366 CTGGTCATGCAGGATCCTGTGGG - Intronic
1161619195 19:5289533-5289555 CAGGTCGTGCAGGACCTGGTGGG - Intronic
1161621412 19:5299225-5299247 CAGGTCATGCAGGGCCTTGTGGG - Intronic
1161624697 19:5319608-5319630 TAGGTCATGTAGGGTCTTGTGGG - Intronic
1161634238 19:5377234-5377256 CAGGTCATGCAGGGCCTTGTGGG + Intergenic
1161644489 19:5444680-5444702 TAGGTCATGCAGGGCCTTGTGGG - Intergenic
1161657167 19:5523396-5523418 CAAATCATGCAGGCCTTTGTGGG - Intergenic
1161684848 19:5697613-5697635 CAGGTCATGCGGGGTCCTGTGGG + Intronic
1161875438 19:6905022-6905044 CAGATTCTGCAGGGTCTTGGTGG + Intronic
1162148624 19:8629428-8629450 CAGGTCATGAAGGGCCTTGTGGG + Intergenic
1162828761 19:13270910-13270932 TAGATCATGCAGGAACTGGGAGG - Intronic
1162829965 19:13278260-13278282 CAGATCGTGCAGGGGCTTGAGGG - Intronic
1162837869 19:13333163-13333185 CAGATCAAGCAGGGGCTTATAGG - Intronic
1162875310 19:13616917-13616939 CAGATGGTACAGGGTCTTGTGGG + Intronic
1163000130 19:14362063-14362085 CAGATCCTGCAGGGCCCTGTGGG + Intergenic
1163155306 19:15436963-15436985 CAGCTCCTGCAGGATGTTGATGG + Exonic
1163187124 19:15646766-15646788 CAGAACATGTTGGATCATGTAGG + Intronic
1163221904 19:15927719-15927741 CAGAACATGTTGGACCTTGTAGG - Intronic
1164478678 19:28594720-28594742 CAGGTCATGCAGGCTCCTGGAGG - Intergenic
1165322674 19:35095980-35096002 CAGATCCTGTAGGGCCTTGTGGG + Intergenic
1165639706 19:37373899-37373921 CAGATCATGAACCACCTTGTTGG + Intronic
1165661326 19:37582989-37583011 CAAATCATGTAGGACCTTGTTGG - Intronic
1165736976 19:38183150-38183172 CAGACCATGGAGGGTCTTGAGGG + Intronic
1166563672 19:43750164-43750186 CAAATCATGTAGGACCTGGTAGG - Intronic
1166690114 19:44817426-44817448 CAGACCAGGCAGCATCTTTTAGG + Intronic
1166984268 19:46650056-46650078 CAAGTCACGCAGGGTCTTGTAGG - Intronic
1167297230 19:48658469-48658491 TAGATCATGCAGGGCTTTGTGGG + Intergenic
1167325087 19:48819479-48819501 CAGATCAGGCAGGGCCTTGAAGG - Intronic
1167490637 19:49790999-49791021 CAGACCCTGCAGGGCCTTGTTGG - Intronic
1167564535 19:50248176-50248198 CAGATCATGCAGGGTCTTAGGGG + Intronic
1167611195 19:50508438-50508460 CAGACCACGCAGGGCCTTGTGGG - Intronic
1168086714 19:54053112-54053134 TAGAGCATCTAGGATCTTGTGGG - Intronic
925875666 2:8309309-8309331 CTGAGCATGCCGGATCTTGTTGG - Intergenic
926363612 2:12113175-12113197 CAGATCGTGCTGGGCCTTGTGGG + Intergenic
927601805 2:24449298-24449320 CAGATCATGTAGATCCTTGTAGG - Intergenic
928187324 2:29123731-29123753 CAGGTCATGCGGGGTCATGTAGG + Intronic
928443929 2:31316348-31316370 CAGAGCATGCAGGCACTTGCAGG - Intergenic
929408879 2:41674088-41674110 AAGATCATGCAGGATCTCATAGG + Intergenic
929982254 2:46692464-46692486 CAGATCATGCAGAACTTTGAAGG - Intergenic
930282340 2:49385436-49385458 TAGATCATATAGGATCTTGAGGG - Intergenic
931065191 2:58578264-58578286 CAGATCATGCTGGACCTTGTGGG + Intergenic
931339211 2:61382280-61382302 CAGATTATTCAGGACCTTGTAGG - Intronic
931669642 2:64635934-64635956 CACATCATGGAGGTGCTTGTTGG - Exonic
931973690 2:67619089-67619111 CAGATCATGGAGGGGTTTGTGGG + Intergenic
932370552 2:71183787-71183809 AAGAGCATGAAGGATCTTATTGG + Exonic
932633919 2:73371316-73371338 CAGATCATGTAGGCTCCTGTAGG + Intergenic
932760893 2:74438589-74438611 CAGATCATGCAGGGCCTTGAAGG - Intronic
933644723 2:84801386-84801408 CAGCTCATACAGTATCTTGCAGG - Intronic
936725448 2:115309530-115309552 AATATCATGCAGGATATTTTGGG + Intronic
936981479 2:118269207-118269229 CAGATCATGAAGCTTCTAGTAGG + Intergenic
937208111 2:120249811-120249833 CAGATGATGCAGGGGCTTCTCGG - Intronic
937487843 2:122334458-122334480 CAGATCATACAGGGTCTTACTGG - Intergenic
937940791 2:127284321-127284343 CAGGTCTTGTAGGACCTTGTAGG - Intronic
939321200 2:140625049-140625071 GAGAACATGCAGGATCTTTCAGG + Intronic
939706520 2:145460276-145460298 TAAATTATGCAGGACCTTGTGGG + Intergenic
940368571 2:152876178-152876200 AGGATCATGAAGGGTCTTGTTGG - Intergenic
940736042 2:157453633-157453655 TAGAACATGCAGGACCTTGAAGG - Intronic
941043992 2:160652296-160652318 CAGAGCATGCAGGGCCTTCTAGG - Intergenic
941351504 2:164442835-164442857 AAGCTCTTGCAGGACCTTGTAGG + Intergenic
942177710 2:173350471-173350493 CAGATCATGTGGGACCTTCTTGG - Intergenic
942428134 2:175880757-175880779 TAGATCATGCAGGACCTTCACGG + Intergenic
942664689 2:178304744-178304766 CAGTCCCTGCAGGACCTTGTAGG - Intronic
942860352 2:180602155-180602177 CCGATCAGGCAGGATATTGTAGG + Intergenic
943049431 2:182897181-182897203 TAGATCATGTAGAGTCTTGTGGG - Intergenic
944219362 2:197286960-197286982 CAGAGCATGCAGGATTTTCAGGG + Intronic
944325777 2:198401825-198401847 CAGATCATGCAGGACCTTGTAGG - Intronic
944330046 2:198454719-198454741 CAGATCACTCAGGGTCTTATTGG - Intronic
944395529 2:199262213-199262235 CAGATCATGTAGGGCCTTGCAGG + Intergenic
944668573 2:201976528-201976550 AAGCTCATGTAGGACCTTGTAGG + Intergenic
944911821 2:204317940-204317962 CAGTGGAGGCAGGATCTTGTGGG - Intergenic
945679785 2:212899895-212899917 CAGATCATTCAGGGCCTTATGGG + Intergenic
945906825 2:215603491-215603513 CAGGTCATGGACGGTCTTGTAGG + Intergenic
946217833 2:218199485-218199507 CAGAACATGGAGGAGCATGTTGG - Intergenic
946460688 2:219865894-219865916 TAGATCTTGCAGGACCTTGAAGG - Intergenic
946851372 2:223909981-223910003 CGGGTCATGCAAGGTCTTGTAGG - Intronic
947881172 2:233514545-233514567 CAAATTATTCAGGTTCTTGTAGG + Intronic
948086216 2:235250967-235250989 CAGAGCATGCAGGATTTTTAAGG + Intergenic
948113241 2:235473833-235473855 CTGATCAGGCAGGATGATGTGGG - Intergenic
948202820 2:236142203-236142225 CAGATCACGTAGGACCTTGCAGG - Intergenic
1169783468 20:9333544-9333566 CAGATCGTTCAGGACCTTTTCGG + Intronic
1169815290 20:9650176-9650198 CAGATCATCCAGTCCCTTGTAGG - Intronic
1170243072 20:14191837-14191859 CAGATCATATAGGGTCTTTTAGG + Intronic
1170293289 20:14795135-14795157 CAGACCGTGAAGGACCTTGTAGG + Intronic
1170385225 20:15809208-15809230 CACATCATGCAGTGTCTTGCAGG - Intronic
1170478919 20:16745664-16745686 CTGATCCTACAGGAGCTTGTAGG + Intergenic
1170643534 20:18176729-18176751 CAGATCCTGCAGGATCCTACAGG + Intronic
1171152030 20:22835697-22835719 CAGATCCTGCAGGGCCTTGCAGG + Intergenic
1171242574 20:23583720-23583742 CAGAACATGCACCAGCTTGTAGG - Intergenic
1172199298 20:33114002-33114024 AAGACCCTGCAGGACCTTGTGGG - Intergenic
1172436518 20:34932436-34932458 CAGCTCCTGAAGGATCTTGAAGG - Intronic
1172807105 20:37619913-37619935 CAGAACATGCAGGACCTCGTAGG + Intergenic
1173029075 20:39337940-39337962 CAGATCATGGAGGACCTTCCAGG - Intergenic
1173338655 20:42134847-42134869 CAGATCATGCAAGACATTGCAGG - Intronic
1173418770 20:42881940-42881962 TGGATCATGCAGGATCTTATAGG + Intronic
1173559552 20:43993150-43993172 CGGATCATGCAGGACTTTGCAGG + Intronic
1173587446 20:44193615-44193637 CAGATCATGGAGGGCCTGGTAGG - Intergenic
1173688529 20:44940965-44940987 CAGATCATGCAGGGTCTCCTAGG - Intronic
1173861634 20:46287649-46287671 CACACCGTGCAGGATCTCGTGGG + Intronic
1173876487 20:46375534-46375556 CAGATCATGCTAGATTTTCTAGG + Intronic
1173916722 20:46713546-46713568 CAGATCCTGCAGAGTCTTGAAGG + Intronic
1174003209 20:47389868-47389890 AAGATCATGGAGGAACTTGGAGG - Intergenic
1174006517 20:47415486-47415508 CAGGTCACGGAGGAACTTGTAGG - Intergenic
1174115299 20:48222837-48222859 CAGATCCTGCAGGCCCTTGTGGG + Intergenic
1174277371 20:49413752-49413774 CAGATCAGACAGGGTCTTGAAGG - Intronic
1174466715 20:50723489-50723511 CAGATCATGCAGCCTCTTGCAGG - Intergenic
1174483431 20:50846564-50846586 CAGATCATGCACCCTCTTGCAGG - Intronic
1175024665 20:55889156-55889178 CAGATTGTGCAGGGCCTTGTGGG + Intergenic
1175112252 20:56656896-56656918 CAGAGCATGCAGCATCTGGCCGG + Intergenic
1176958184 21:15129999-15130021 TAGATCATGCAGGATCTTGAAGG + Intergenic
1177922371 21:27168712-27168734 CAGATCATATAGTACCTTGTGGG - Intergenic
1178455153 21:32742323-32742345 CAGATGATAGAGGATCTTGTAGG - Intronic
1178942419 21:36917163-36917185 CAGATCATGTAGGAGCTGGCAGG - Intronic
1178974644 21:37210357-37210379 CAGATTATGCAGGAGTTTCTAGG + Intergenic
1180012325 21:45059136-45059158 AAGATCATGGAGGATTTTGCAGG + Intergenic
1180255079 21:46621344-46621366 CAGAGCACGAAGGAGCTTGTGGG + Intergenic
1180981817 22:19881914-19881936 CAGACCCTGCAGGGTCCTGTAGG - Intronic
1181888521 22:26040848-26040870 CAGATGATGTAGGGCCTTGTAGG + Intergenic
1182001937 22:26926830-26926852 CAGATTGTGCAGGATCTTGCAGG + Intergenic
1182048350 22:27294375-27294397 CAGATCCTGCAGATTCTAGTGGG + Intergenic
1182190381 22:28453908-28453930 TAGATCATGTATGACCTTGTAGG - Intronic
1182311209 22:29408973-29408995 CAGATCATGCTGGGTTCTGTTGG - Intronic
1182689891 22:32152133-32152155 CAGATCATGCTGGGTTCTGTTGG + Intronic
1182819359 22:33201728-33201750 CAGATCCTGTTGGGTCTTGTAGG + Intronic
1182928876 22:34154051-34154073 TGTATCATGTAGGATCTTGTGGG + Intergenic
1183380278 22:37487230-37487252 CAGCTCACGCAGGGCCTTGTGGG - Intergenic
1184419325 22:44370391-44370413 CAGAGCCTGCAGGGCCTTGTGGG + Intergenic
1184637801 22:45848971-45848993 CAGATCATGCAGGGTCTTCAAGG + Intergenic
949478729 3:4472998-4473020 TAGATCATGGAGGACCTTCTTGG - Intergenic
949735853 3:7170818-7170840 CAGGTCATACAGAATCATGTAGG - Intronic
949842955 3:8340036-8340058 CACATCATTCAGGACCTTATAGG - Intergenic
950076552 3:10191458-10191480 TAGACCATGCAGGGCCTTGTAGG - Intronic
950294092 3:11813029-11813051 TAGATCATGCAGGCTTTTATAGG + Intronic
950617954 3:14177607-14177629 CAAAACATGTAGTATCTTGTAGG + Intronic
950915177 3:16637418-16637440 CAGATGATGCAGGTTATTGCAGG - Intronic
951103363 3:18714854-18714876 TAGATCATACTGGGTCTTGTAGG - Intergenic
951277798 3:20710949-20710971 CAGATCATGCAAGGCCTTGTAGG + Intergenic
951738572 3:25895462-25895484 TGGATCATGTAGGACCTTGTAGG - Intergenic
952134931 3:30407833-30407855 GAGATCATGCAGGGTTTTGTGGG - Intergenic
952498343 3:33935765-33935787 CAGAGCATCCAGGGTCTTGTGGG + Intergenic
952769436 3:36984481-36984503 CAGAGTATGCAGGGTCTCGTAGG + Intergenic
953877786 3:46676295-46676317 CAGCTCCTGCAGGTGCTTGTTGG + Exonic
954530329 3:51313209-51313231 AAGAGCATGGAGGATCTTATAGG - Intronic
954538372 3:51378014-51378036 AAGCTCATGCTGCATCTTGTAGG + Intronic
955433536 3:58874494-58874516 CAGAACATGCAGGGTTTTGCGGG - Intronic
955676322 3:61452753-61452775 CAGATCATTCAGGGTCCTGTAGG - Intergenic
955765840 3:62343218-62343240 CAGGTCATGTAGGATTTTCTAGG - Intergenic
955891213 3:63652092-63652114 CAGGCCATGCAGGAACTTTTAGG - Intergenic
956402599 3:68896178-68896200 CAGACCAGGCAGAAGCTTGTAGG + Intronic
956499292 3:69864695-69864717 CAGACCATGAAGGATCTGGTAGG - Intronic
957225192 3:77434117-77434139 GAGATAATGCAGGGTCTTGTAGG - Intronic
957849449 3:85787799-85787821 CAGATCATGCAGGACTTGTTAGG - Intronic
957966918 3:87333806-87333828 TAGAGCATGAAGGATCATGTAGG + Intergenic
958152726 3:89711995-89712017 CAGATTATGTAGGATATTATAGG - Intergenic
958777210 3:98500298-98500320 CAGGTCATGCAGACTCCTGTGGG - Intronic
959208945 3:103351063-103351085 CAGATCATGTAGGATCTTTTAGG + Intergenic
959216480 3:103456432-103456454 CAGATAACGTAGGGTCTTGTAGG + Intergenic
959399637 3:105883914-105883936 CAGACCATGCAGGGCTTTGTAGG - Intergenic
959575775 3:107931702-107931724 TAGATCTTGAAGTATCTTGTAGG + Intergenic
959689431 3:109182632-109182654 CAGATCATGCAGGGCCTTGAAGG - Intergenic
959689727 3:109185836-109185858 CAGACCATGCAGAAACTTATAGG + Intergenic
959999888 3:112720150-112720172 CACATCATACAGGATTTTGTCGG + Intergenic
961751940 3:129101745-129101767 CAGAGCATATAGGATCTTGCAGG + Intronic
961951076 3:130749779-130749801 CAGATCATGCAAGGTTTTGTGGG - Intergenic
962072713 3:132048360-132048382 TGGATCATGCAGGACCTTGCAGG - Intronic
962776647 3:138667321-138667343 AAGACCATGCAGGTTCCTGTTGG + Intronic
962843816 3:139258360-139258382 CAAATCATGGAGGATGCTGTGGG + Intronic
963219171 3:142788060-142788082 CAGACCATGCATGGCCTTGTAGG + Intronic
964104441 3:153023932-153023954 CAGATTATGAAGAGTCTTGTGGG - Intergenic
964260560 3:154830762-154830784 CGGAACATGCAGAAACTTGTAGG + Intergenic
964373950 3:156031269-156031291 CAGATCATGCAGGGCCCTGTTGG + Intergenic
964435996 3:156654412-156654434 CAAATCATGCATGGCCTTGTGGG + Intergenic
964466227 3:156996442-156996464 CACATCATGCAGGGCCTTGCAGG + Intronic
964763722 3:160158380-160158402 TGGATCATGCAGGGCCTTGTAGG - Intergenic
965690112 3:171346851-171346873 CAGATCATCCTGGGCCTTGTAGG + Intronic
965824264 3:172714707-172714729 CAGATCATTTAGGACCATGTAGG + Intergenic
966160495 3:176962491-176962513 CAGGTCATGCAGGACCTTGCAGG + Intergenic
966261619 3:177985153-177985175 CAGGTCATGCAGGGTGTGGTTGG + Intergenic
966351327 3:179035229-179035251 CAGATCATGTAGGGCCTTATAGG - Intronic
966809023 3:183827117-183827139 CAGACCATGGAGGGTCTTGGTGG + Intergenic
967702578 3:192610704-192610726 CAGATCTTGCAGGGCCTTGCAGG - Intronic
967764465 3:193263035-193263057 CAGCTCTTGAAGGATGTTGTGGG + Exonic
968292858 3:197552461-197552483 CAGAACATGGAGGGCCTTGTAGG - Intronic
970498984 4:16657569-16657591 CAGATAATGTAGGGCCTTGTAGG - Intronic
970854689 4:20638183-20638205 CAGAGACTGCAGGATCTTGAAGG - Intergenic
971130557 4:23804617-23804639 CAGACCATACAGGGCCTTGTAGG - Intronic
971404058 4:26304107-26304129 CAAATCATGAAAGATCTTGTGGG - Intronic
971459562 4:26880101-26880123 CAGATCATGCAGCAATTTGCAGG - Intronic
972312397 4:37892997-37893019 CAGATCTTCTAGGATCTTCTAGG + Intronic
972474965 4:39441462-39441484 TAGCTGAAGCAGGATCTTGTAGG - Intronic
973256848 4:48122221-48122243 CAGATCATGGAGCATTTTATAGG - Intronic
974010092 4:56598733-56598755 CAGATCATGTAGGGCCTTGTAGG + Intronic
974417191 4:61624051-61624073 CAGATCATGCAAGGTCTTACTGG + Intronic
974719540 4:65719709-65719731 CAGAACATGAAGTATCTTGCAGG + Intergenic
974889621 4:67865248-67865270 AAGATCATTCAGGAGCATGTTGG - Intronic
975413855 4:74085657-74085679 TAAATCATACAGGATTTTGTTGG - Intergenic
975441582 4:74417358-74417380 CAAATCATGCGGGAGCTTTTGGG + Intergenic
975854451 4:78608409-78608431 CAGATCATGCAGGACCTTTTTGG + Intronic
978103051 4:104866815-104866837 CAGATCATACAGGTCCTTGTAGG - Intergenic
978215018 4:106189792-106189814 AGGATCATGCAGCATCTTGTAGG - Intronic
978537167 4:109774583-109774605 CAGATCTTGTAGGAACCTGTTGG + Intronic
978634660 4:110789937-110789959 CACATCATGCAGGAGGTTTTGGG + Intergenic
978761120 4:112357239-112357261 CAGATCATCCAGCATCTGGCAGG + Intronic
978905825 4:114004525-114004547 CAGATCTTGCAGGACCTAATAGG - Intergenic
979412645 4:120397380-120397402 CAGATCATGCAGTGGCTTCTGGG + Intergenic
979864446 4:125736333-125736355 CAGATCATGGAGGTCATTGTAGG + Intergenic
979901845 4:126230663-126230685 CAGGCCATGCAAGGTCTTGTAGG + Intergenic
980051231 4:128042340-128042362 TAGATTATGCAGGGTCCTGTAGG + Intergenic
980091441 4:128447306-128447328 CAGATCATGTTGGACCTTCTAGG + Intergenic
981593566 4:146392838-146392860 AAGGTCATGCAGTGTCTTGTGGG - Intronic
981610323 4:146587157-146587179 CAGATCATATAGGATCTTAAAGG - Intergenic
981702296 4:147619934-147619956 CAGATCATGTTGGACCTTGATGG - Intronic
981721695 4:147808417-147808439 CAGATCATGCAGGGTCTTTCAGG + Intronic
982059055 4:151584687-151584709 CAGATCCTGCAGGGTTTTATAGG - Intronic
982350267 4:154407719-154407741 CAGACCCTGCAGGAACTTATGGG - Intronic
983430409 4:167642887-167642909 CAGGTCATGCAGAAACTTCTAGG - Intergenic
984089941 4:175360602-175360624 CAAATTCTGCTGGATCTTGTCGG + Intergenic
984823268 4:183903187-183903209 CAGATCATGCCGGAACTTGCAGG - Intronic
985759534 5:1738168-1738190 CAGAGCATGAAGGATTTTTTAGG - Intergenic
986748619 5:10765221-10765243 CCCATCATGCAGGGTCTGGTAGG - Intergenic
987246943 5:16058749-16058771 TAGATCACGTAGGACCTTGTGGG + Intergenic
987493582 5:18614281-18614303 CAGATCTTGCAGTACCATGTTGG + Intergenic
987815215 5:22891590-22891612 AACATCATGCAGGATCATATAGG - Intergenic
988848625 5:35156492-35156514 CAGATCCTGGAGAGTCTTGTAGG - Intronic
989488464 5:42021039-42021061 CAGATCACACAGGGTCCTGTAGG + Intergenic
989807195 5:45624110-45624132 CAGATAATGCAGGACCTTATGGG + Intronic
990887189 5:60607940-60607962 CAGATCATGCAGAACTTTGTAGG + Intronic
990911087 5:60853033-60853055 CAGATCACAAAGGCTCTTGTAGG - Intergenic
991633779 5:68682555-68682577 CAGATTAGGCAGGCTCTTGCAGG - Intergenic
992182282 5:74210415-74210437 CACATTGTGCAGGGTCTTGTAGG - Intergenic
992238135 5:74733640-74733662 CATATCATGTAAGGTCTTGTAGG + Intronic
992716993 5:79520783-79520805 CAGATCATGCAGTACCTCTTAGG - Intergenic
992969413 5:82040831-82040853 CAGATCATCTAGGGACTTGTTGG - Intronic
993714298 5:91259736-91259758 CAGCTCATGCAGGGCTTTGTAGG - Intergenic
993946214 5:94119901-94119923 CAGATCATGCAGGACTTTATAGG - Intergenic
994044127 5:95289120-95289142 CAGATGATACAGGATTCTGTAGG + Intergenic
994416096 5:99473724-99473746 CAGATCATACTGTTTCTTGTTGG - Intergenic
994463873 5:100101448-100101470 CAGATCATACTGTTTCTTGTTGG + Intergenic
994992070 5:107009526-107009548 CAGATCATATAGGGTTTTGTAGG + Intergenic
995092585 5:108195507-108195529 CAGATCACATAGGGTCTTGTGGG + Intronic
995095906 5:108235660-108235682 CAGATCATGCGGGGCCTTATAGG - Intronic
995640843 5:114255546-114255568 CAGATAAGGCAGGGCCTTGTAGG + Intergenic
995982113 5:118117003-118117025 CAGATCATAAATGACCTTGTGGG + Intergenic
996204022 5:120708879-120708901 CAGATGATGCAAAAACTTGTAGG + Intergenic
996257443 5:121422613-121422635 CAGAGCATGCAGGAACTTTTAGG + Intergenic
996550671 5:124726758-124726780 CAGGTCATGCAGGGCCTTGTAGG - Intronic
996918444 5:128737946-128737968 CAGATCACACAGGATCTTACTGG - Intronic
997018161 5:129962593-129962615 CAGACCATGCAGGATCTCATGGG - Intronic
997448797 5:133965038-133965060 CAGATCATGTAGGATCTTGAAGG - Intronic
997624001 5:135319406-135319428 CTGATCATGTTGGGTCTTGTGGG + Intronic
997636542 5:135411213-135411235 GGGATCATGAAGGATCTTGTTGG + Intergenic
997705037 5:135942506-135942528 CAGACCTTGCAGGACCTTGTGGG - Intronic
997745695 5:136298396-136298418 CAGGTCATGCAGCACTTTGTAGG + Intronic
997898992 5:137746369-137746391 CAGATCATGTAGGGATTTGTAGG - Intergenic
997958890 5:138303413-138303435 CAGATCGTGTAGGGCCTTGTAGG - Intronic
998010699 5:138693225-138693247 CAGATCATGAATGACCTTATAGG - Intronic
998120951 5:139577328-139577350 TAGTTCATGCAGGTTCTTTTGGG + Intronic
998692627 5:144604021-144604043 CAGATCAAGTAGGACCTTGCAGG + Intergenic
998767644 5:145506157-145506179 CAAATCATACAGGCTCTTGTGGG - Intronic
998881400 5:146648909-146648931 CAGATCACGCAGAATCTTATAGG + Intronic
998895334 5:146792839-146792861 CAGATGATGTAGGGTCTTGCAGG + Intronic
999411270 5:151351936-151351958 TGGATCATGCAGGACCTTGTGGG - Intergenic
999559162 5:152781166-152781188 CAGATCATGTAGGGCCTTGCAGG - Intergenic
999572147 5:152931303-152931325 CAGATTATACTGGAACTTGTAGG - Intergenic
999591915 5:153157610-153157632 CAGATGGTGCAAGATCTCGTAGG + Intergenic
999861393 5:155650687-155650709 CAGATCATGTAAGAACTTGTGGG + Intergenic
1000541028 5:162540233-162540255 CAGATCATGAAGGACTTTATGGG + Intergenic
1000808893 5:165835896-165835918 AAGATCTTGTAGGGTCTTGTAGG + Intergenic
1000978985 5:167796312-167796334 TAGATCATGCAGCCCCTTGTAGG - Intronic
1001660226 5:173385705-173385727 TAGATGGTGCAGGATCATGTAGG - Intergenic
1001948719 5:175801066-175801088 GAGATCATGCAGGCCCTTCTAGG + Intronic
1003455600 6:6278791-6278813 CAGATCAAGCAGGGCTTTGTAGG + Intronic
1004817642 6:19329946-19329968 CAGATCATATAGGGTCCTGTAGG + Intergenic
1005152290 6:22766155-22766177 AAGGGCATGGAGGATCTTGTGGG - Intergenic
1006548108 6:34796258-34796280 CAGATGATAAAGTATCTTGTTGG + Intronic
1006692266 6:35899242-35899264 CAGATCACGTAAGGTCTTGTAGG - Intronic
1007528078 6:42514341-42514363 CAAATCATGCAGGGGCTTGCAGG + Intergenic
1008629898 6:53353612-53353634 AAAATCATGAAGGATCTTATAGG - Intergenic
1008662545 6:53682944-53682966 CAGAGCATGCAGGATTATCTAGG + Intergenic
1008775764 6:55035719-55035741 CAGATCATGTAGGACCCCGTAGG - Intergenic
1010259243 6:73796266-73796288 CAGATCACCCAGGACCCTGTAGG - Intronic
1010308101 6:74348786-74348808 CAGATCATTCAGGAACCTGTAGG + Intergenic
1011801365 6:91019740-91019762 CAGGTCCTGCAGGACTTTGTGGG - Intergenic
1012188126 6:96247298-96247320 CAGATCATGTAGGACTTTGTAGG + Intergenic
1012397032 6:98810453-98810475 CAGATCATACAGGGCATTGTAGG - Intergenic
1012698066 6:102415311-102415333 CAGATTATGTAGGATTTTCTAGG + Intergenic
1012783456 6:103592231-103592253 CAGATCATGTATGGCCTTGTAGG - Intergenic
1013396540 6:109746620-109746642 CAGACCATGCAGAGTATTGTAGG + Intronic
1013548437 6:111183121-111183143 CAGATTGTGAAGGACCTTGTAGG - Intronic
1014805788 6:125827849-125827871 CAGATCATGCAGGGCCTTCTTGG + Intronic
1015209959 6:130685771-130685793 GAGATAATGAAGGACCTTGTAGG + Intergenic
1015228636 6:130887519-130887541 CAGATCATGCAGGGCCTTGGAGG - Intronic
1015255849 6:131178842-131178864 CAGAACATGGAGGATATTGTGGG - Intronic
1015359821 6:132327022-132327044 CAGACCATCTAAGATCTTGTAGG - Intronic
1015911097 6:138168440-138168462 CAGATCATGAAAGTCCTTGTTGG + Intronic
1015940921 6:138451107-138451129 TAGATCATGTAGGGTCTTGGAGG - Intronic
1016492007 6:144615898-144615920 CTGATCATGTAGGACCTGGTAGG - Intronic
1016699993 6:147043531-147043553 CAGATCACATAGGATCTTGGAGG - Intergenic
1017043435 6:150325708-150325730 GAAATAATGCAGGAACTTGTAGG + Intergenic
1017365169 6:153627497-153627519 CAGATTATGAAGGGTCTTGTAGG + Intergenic
1017861144 6:158398355-158398377 CAGAGCAAGCAGGCTCCTGTTGG + Intronic
1018684038 6:166289518-166289540 TAGATCATGCAGAGTCTTGTAGG - Intergenic
1019375364 7:688502-688524 CAGATCACGCAGGGCCTTGCTGG - Intronic
1020025376 7:4896011-4896033 CATACCATGCAGGGTCATGTGGG - Intergenic
1020524060 7:9235835-9235857 CAGATCATGCAGCAACTTGTTGG + Intergenic
1020759402 7:12249662-12249684 GAGAGCATGAAGGATCTTGTGGG + Intergenic
1021292744 7:18866085-18866107 CAGTTCATGTAGCATCTCGTAGG - Intronic
1021919153 7:25466245-25466267 CACAACATGCAGGAACTTGGTGG + Intergenic
1022378734 7:29840233-29840255 CAGACCATGCAGGATGGAGTGGG - Intronic
1022592935 7:31683605-31683627 GAGATCTTGCTGGATCTCGTTGG - Intergenic
1022606271 7:31817440-31817462 CAGATCATGCAGGGCTTTGGAGG + Intronic
1022656950 7:32328446-32328468 CAGATCATGCAGGGACTTGGAGG - Intergenic
1023066687 7:36384934-36384956 CAGATCATGCATGGCCTTGTAGG + Intronic
1023268095 7:38429806-38429828 CAGATCATTCTGGATTTTTTTGG - Intronic
1024783826 7:52883170-52883192 CTGATCAAGCAGCATCTTCTAGG - Intergenic
1026241768 7:68581716-68581738 CAGATCATGTAGGGTCTTGTAGG - Intergenic
1026375526 7:69746721-69746743 CAGGTCATATAGGACCTTGTAGG + Intronic
1026450005 7:70520319-70520341 CAGATCAGGGAAGACCTTGTGGG - Intronic
1027421908 7:78025059-78025081 CAGATCATGCAGGCTTTTTTAGG - Intronic
1027645335 7:80790488-80790510 CAGATCATGCAGAGGCCTGTAGG - Intronic
1028250423 7:88533626-88533648 CAGAGCATGCAAGGTCTTGCAGG - Intergenic
1028981752 7:96974964-96974986 CAGATCCTGAAGGGCCTTGTAGG - Intergenic
1029360975 7:100088604-100088626 CAGATCAGGCAGGGCCTTGCAGG + Intergenic
1029856724 7:103524950-103524972 GATATCAGGCAGGACCTTGTGGG - Intronic
1030115692 7:106060626-106060648 CCGCTCACGCAGGATCTTGCTGG + Intergenic
1030487526 7:110189091-110189113 CAGATCATGCAGGACTTTGTAGG + Intergenic
1030618205 7:111760874-111760896 CAGATCATTCAGGTACTTTTTGG - Intronic
1031417965 7:121516084-121516106 CAGATCTTGTAGGATCTTGAAGG - Intergenic
1031560477 7:123232172-123232194 CAGATTATCCAGGACCTTGTAGG - Intergenic
1032043544 7:128582725-128582747 CAGATCACGCAGGAGCTTTTAGG - Intergenic
1032429178 7:131847058-131847080 CACATCATGCAGGACCTCTTTGG + Intergenic
1033133732 7:138767767-138767789 CAGATCATGGAGGACCCTGGGGG - Intronic
1034547019 7:151795649-151795671 CAGATCATGCTGAATGATGTGGG + Intronic
1036227659 8:6973418-6973440 CAGATCATGCCGGTTCATGAAGG - Intergenic
1036230113 8:6992577-6992599 CAGATCATGCTGGTTCATGAAGG - Intergenic
1036232565 8:7011680-7011702 CAGATCATGCTGGTTCATGAAGG - Intronic
1036411982 8:8510682-8510704 AGGATCTTGCAGGATCCTGTAGG + Intergenic
1036505280 8:9349238-9349260 CAGATCATGCAGGGTCTTATCGG - Intergenic
1036598534 8:10238051-10238073 CAGATAGTGTAGGACCTTGTGGG - Intronic
1036926933 8:12916077-12916099 CAGGTCATGAAGGGTCATGTGGG - Intergenic
1037316464 8:17604047-17604069 CAGACCATGGAGGGCCTTGTTGG + Intronic
1037462960 8:19131548-19131570 CAGGTCAGGCAGGGCCTTGTTGG + Intergenic
1037561203 8:20076080-20076102 CAGATACTGCAGGGTCTTGTAGG - Intergenic
1037593202 8:20330698-20330720 TAGCTCCTGCAGGATTTTGTTGG + Intergenic
1038669206 8:29568664-29568686 AAGTCCATACAGGATCTTGTTGG + Intergenic
1038887720 8:31683559-31683581 CAGAGCATGTAGGATCTTCAGGG + Intronic
1039050262 8:33486127-33486149 GAGGTCATGCAGAATCTTGTAGG + Intronic
1042096903 8:65226144-65226166 CAGATCACGCAGGGCCTTGTAGG + Intergenic
1042150798 8:65781368-65781390 CAGATCATGCTGGACCTTTGTGG + Intronic
1042307460 8:67346410-67346432 CAGATCATTCAGACTCTCGTAGG + Intergenic
1042685441 8:71433774-71433796 CAGATCATTCAGCATCCTGAAGG + Intronic
1042737306 8:72004047-72004069 CAGATCAGGCAGAATCCTGACGG + Intronic
1043325125 8:79040735-79040757 CAGATCATGCATTAACTTGAAGG + Intergenic
1043551192 8:81374953-81374975 CAGATCCTGTAGGACTTTGTGGG + Intergenic
1043848598 8:85190064-85190086 CAGACTAGGCAGGATCTTGTAGG - Intronic
1044340075 8:91036758-91036780 CAGCCCATCCAGGATATTGTTGG - Intronic
1044489387 8:92793995-92794017 TAGATCATGGAGGATGTGGTTGG + Intergenic
1044847174 8:96393273-96393295 CAGACCTTGCATGATGTTGTGGG - Intergenic
1044889826 8:96822607-96822629 CATATCATGCAGGACCTCCTGGG - Intronic
1044934473 8:97279448-97279470 CAGATCATACAGGGCCTTGCAGG - Intergenic
1045663092 8:104458270-104458292 CAGGTCATGCAGGACCTTATGGG - Intronic
1045977382 8:108145074-108145096 CAGATCATGCAGGACCCTCTTGG + Intergenic
1046078284 8:109338064-109338086 CAGATCATGAAGGATCATGTAGG + Intronic
1046214058 8:111118472-111118494 CAGAACATGCAGGATCATATGGG + Intergenic
1046290208 8:112149352-112149374 CAGATTAGGCAGAGTCTTGTAGG - Intergenic
1046348621 8:112973106-112973128 CAGATCATGCAGTTTCCCGTGGG + Intronic
1046582005 8:116104490-116104512 CAGATCATTCAAGGTCTTGCAGG - Intergenic
1046814417 8:118568383-118568405 CAGATCATGCAGGATCTGGTAGG + Intronic
1046902413 8:119537497-119537519 CAAATTATGCAGGTTCTTATAGG - Intergenic
1047285027 8:123480345-123480367 CAGATCATGCAGGGTCTTTGTGG + Intergenic
1047971867 8:130091502-130091524 CCGATCATGCAGGGCCCTGTGGG + Intronic
1048334815 8:133494639-133494661 CAGTTCATGTAGGATCTTGCAGG - Intronic
1048445349 8:134489068-134489090 CAGATCATGAAGGATCTTATAGG + Intronic
1048485630 8:134844771-134844793 TAGAACCTGCAGGATATTGTGGG - Intergenic
1051027949 9:12636621-12636643 CAGGACATGCAAGATCTGGTAGG - Intergenic
1051557279 9:18398705-18398727 CAGATCTGGTAGGATCTTATAGG + Intergenic
1051564829 9:18485759-18485781 CAGATCATGCAGGGTGTTGCAGG + Intronic
1051650650 9:19321017-19321039 CAGGTTATGCAGGATCTTTTAGG + Intronic
1054861835 9:69961793-69961815 CAGATCATGATGGATCTTGCAGG + Intergenic
1055392530 9:75838390-75838412 CAGATCATGGAGAACCTGGTGGG - Intergenic
1055410303 9:76021833-76021855 CAAATCATTCAGGGTGTTGTAGG - Intronic
1055434240 9:76276449-76276471 AAGATCATATAGGATCTTATAGG - Intronic
1055660122 9:78494872-78494894 CAGATCATGCAAGGCTTTGTGGG + Intergenic
1055763542 9:79636382-79636404 CAGCTCATGAAGAATCTTGTAGG - Intronic
1056139686 9:83663888-83663910 CAGATGCTGCAGGCTCTTGCTGG - Exonic
1056223694 9:84474258-84474280 AAGAACATGCAGGATGTTTTAGG + Intergenic
1056289274 9:85126387-85126409 CAGGTCATGCAGGATCTTCTGGG + Intergenic
1056736641 9:89215429-89215451 CTGTTTATGCAGGACCTTGTGGG - Intergenic
1058126282 9:101198895-101198917 CAAATCATGCAGTAACTTGCAGG + Intronic
1058340439 9:103888991-103889013 CAGTTCAAGAAGAATCTTGTAGG + Intergenic
1058532821 9:105924057-105924079 CAGATCCTGCAAGGCCTTGTGGG - Intergenic
1058547251 9:106073758-106073780 CAGATCATGGATGATCTTGAGGG - Intergenic
1059268112 9:113055026-113055048 CAGATAATGTAGGATTTTATTGG - Intronic
1059348245 9:113646795-113646817 CAGATCACGCAGGGCCTTGAAGG - Intergenic
1059354113 9:113686596-113686618 TAGATCCTGCAGGCTCTTCTGGG + Intergenic
1059592187 9:115673675-115673697 CAGATCATGCATGGCTTTGTAGG - Intergenic
1059604029 9:115813461-115813483 CAGGTCATGAAGGACCATGTGGG - Intergenic
1059632318 9:116137703-116137725 CAGGTCACCAAGGATCTTGTTGG - Intergenic
1060429292 9:123535482-123535504 CAGATTGTGAAGGGTCTTGTGGG - Intronic
1060463655 9:123882931-123882953 CAGATCATGTAGGACTTTGTAGG - Intronic
1060908081 9:127325971-127325993 CAGATCATGCAGGCTCCAGCAGG - Intronic
1062386487 9:136313761-136313783 GTGATCACGCAGGCTCTTGTTGG - Intergenic
1186341040 X:8646382-8646404 CAGATAAAGTAGGATTTTGTGGG + Intronic
1186592392 X:10944570-10944592 CAGATCTTGTAGGGTCATGTGGG - Intergenic
1186722695 X:12322577-12322599 CAGGTCATTCAGGGCCTTGTAGG + Intronic
1187202257 X:17146181-17146203 CAGATCGTACAGGGCCTTGTGGG - Intronic
1187237074 X:17477464-17477486 CAAGACATGCAGGATCTTTTGGG + Intronic
1187245639 X:17550852-17550874 CAGATCACATAGGGTCTTGTGGG - Intronic
1187248494 X:17575270-17575292 CAGGTCATGCAGGGCCTTGCAGG - Intronic
1188232150 X:27677663-27677685 CAGGTCATGCAGGACCTTGCAGG + Intronic
1188661365 X:32762743-32762765 CAGATCACACAGGGTCTTGCTGG + Intronic
1189537986 X:41956206-41956228 CAGATCATGTAGGGCCTTGTAGG - Intergenic
1190302561 X:49065167-49065189 CTGATCATGCAGGATGTGGTCGG - Intronic
1190336825 X:49267645-49267667 TAGACCACGCAGGACCTTGTAGG + Intergenic
1190489342 X:50965394-50965416 CAGATCATGTAGGATTTTGTAGG - Intergenic
1190702120 X:52996894-52996916 CAGATTATACAGGACCTTCTGGG + Intergenic
1190937948 X:55013485-55013507 CAGATGATGGAAGATTTTGTGGG - Exonic
1191853700 X:65605624-65605646 TAGATCATGTAGGCTCTTTTGGG - Intronic
1191901539 X:66045832-66045854 TATATTATGCAGGTTCTTGTAGG + Intergenic
1192099018 X:68244042-68244064 CAGATCATAGGGGATTTTGTAGG - Intronic
1192273832 X:69610180-69610202 CAGATCATGTAGGGCCTTGTAGG + Intergenic
1192280119 X:69676116-69676138 CAGATCATGTAGGGCTTTGTAGG + Intronic
1192340777 X:70261663-70261685 CAGATCATGAAGGTCCTTGGAGG + Intergenic
1192555211 X:72083863-72083885 CAGATCGTGCAGGGCCTTCTAGG - Intergenic
1192596001 X:72408850-72408872 CAGATCATGTAGGGTGTTGTAGG + Intronic
1193624707 X:83803842-83803864 TAGATCATGTAGGGCCTTGTAGG + Intergenic
1194295695 X:92123865-92123887 CAAATCAGGCAGGATATTGTAGG - Intronic
1194349887 X:92813117-92813139 CAGATCATGCAGGGTTTTACAGG + Intergenic
1194423601 X:93708314-93708336 CAGATCATATAGGACCTTATAGG + Intronic
1194713699 X:97265761-97265783 CAAATCATGTAGGTCCTTGTTGG + Intronic
1194790684 X:98145735-98145757 CAGATCCTGCATGGACTTGTAGG - Intergenic
1195408582 X:104544271-104544293 CAGATCATAAAGGACCTTGTGGG - Intergenic
1195691047 X:107625970-107625992 CTGATCATGCAGAACCTTATAGG - Intergenic
1195700832 X:107704426-107704448 CAGATCACGCAGGCACTTGTAGG + Intergenic
1195725717 X:107913912-107913934 AAAATCATGCAGGACTTTGTAGG - Intronic
1195898587 X:109773607-109773629 CAGATCACACAGGGCCTTGTAGG + Intergenic
1195959227 X:110368326-110368348 TAGATCATGTAGAATCTTGTAGG - Intronic
1196021497 X:110995707-110995729 CAGATTATTCAGGGTCTTCTAGG - Intronic
1196141535 X:112268108-112268130 CAGATTAGGTAGGATCTTGAAGG - Intergenic
1196764657 X:119231952-119231974 CAGATCCTGTAGGGCCTTGTAGG + Intergenic
1196848785 X:119917956-119917978 CAGATCACACAGGGCCTTGTAGG - Intronic
1197712919 X:129684952-129684974 CAGATCAGGCAGGGCCTTCTAGG + Intergenic
1197741707 X:129900057-129900079 CAGATCATGTAGGGCCTTGTAGG - Intergenic
1197793305 X:130277017-130277039 TAGACCAAGCAGGATCTTGAAGG + Intergenic
1197881749 X:131173841-131173863 CAGATCATGTAGGGCCTTTTAGG + Intergenic
1197918478 X:131561978-131562000 CAGATCATTTAGAGTCTTGTAGG + Intergenic
1198229821 X:134678235-134678257 CAGAGCACGCAGGGTGTTGTGGG - Intronic
1198320441 X:135514398-135514420 CAGATCATGCAGGGCCTAGTTGG - Intergenic
1198380840 X:136081973-136081995 CAGATCATGTAAGGCCTTGTAGG - Intergenic
1198448235 X:136739922-136739944 CAGATCCTGGAGGACCTTGGAGG + Intronic
1198464321 X:136890934-136890956 CAAATCATGTAGGTTCATGTAGG + Intergenic
1198710430 X:139495661-139495683 CAGATCATGGAGGTCCTTGTAGG - Intergenic
1198778558 X:140208263-140208285 CAGATCAGGTAGGGGCTTGTGGG + Intergenic
1198789394 X:140327128-140327150 CAGATCATGAAGGGCCTCGTGGG + Intergenic
1198791548 X:140352344-140352366 CAGATCACACAGGGCCTTGTAGG + Intergenic
1198889142 X:141373560-141373582 CAGATCCTGCAGCATATTGAAGG + Intergenic
1199778274 X:151034728-151034750 CAGATCCTATAGGACCTTGTGGG - Intergenic
1199828807 X:151528316-151528338 CAGATCATGTAAGGTTTTGTAGG + Intergenic
1200613198 Y:5348448-5348470 CAAATCAGGCAGGATATTGTAGG - Intronic
1200658206 Y:5929745-5929767 CAGATCATGCAGGGTTTTACAGG + Intergenic
1201503152 Y:14667949-14667971 CAGATCATTCAGGTCCCTGTTGG + Intronic