ID: 1138047676

View in Genome Browser
Species Human (GRCh38)
Location 16:53742799-53742821
Sequence AAGATTAACTAGGTTGTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 192}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138047672_1138047676 11 Left 1138047672 16:53742765-53742787 CCACACTTTATAGATAAAGAAAA 0: 1
1: 7
2: 108
3: 727
4: 3612
Right 1138047676 16:53742799-53742821 AAGATTAACTAGGTTGTTGAAGG 0: 1
1: 0
2: 0
3: 15
4: 192
1138047671_1138047676 30 Left 1138047671 16:53742746-53742768 CCTAACTGGGTATTGTTTGCCAC 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1138047676 16:53742799-53742821 AAGATTAACTAGGTTGTTGAAGG 0: 1
1: 0
2: 0
3: 15
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138047676 Original CRISPR AAGATTAACTAGGTTGTTGA AGG Intronic
902111947 1:14087090-14087112 AAGATTCACTATGATGATGATGG - Intergenic
905265763 1:36753479-36753501 ACGTTTAACAAGGTTGCTGAAGG - Intergenic
905644854 1:39617984-39618006 AAGATCAACTAATTTGTTCAAGG - Intergenic
906295776 1:44648229-44648251 AAGATTAAGTAGCTTGCTCAAGG - Intronic
907949801 1:59171338-59171360 AATATTAACTAGGTGGCTGTGGG + Intergenic
908088362 1:60660852-60660874 CAGTTTAACTAGCTTGTTCAAGG + Intergenic
908143115 1:61208574-61208596 AAGATTAAGTAGTTTGTCTAAGG - Intronic
911262716 1:95705918-95705940 AAGATTGCCTTGGTTGTTCAGGG + Intergenic
918359852 1:183745718-183745740 AAGATTATCTTGGTTGTTTTTGG + Intronic
919002137 1:191846370-191846392 AAAAGTAATTAGGTTGTTGATGG + Intergenic
919783977 1:201245812-201245834 GAGATTAAATAGCTTGCTGAAGG - Intergenic
920608817 1:207417062-207417084 AAGATCAACAAGGTTGTAGTAGG - Intergenic
921594646 1:217041024-217041046 AAGATTATCTGAGCTGTTGAGGG - Intronic
922175883 1:223197254-223197276 AAGTTTAAGTGGCTTGTTGAAGG + Intergenic
1063651692 10:7944398-7944420 AAGAATAATTAGTCTGTTGATGG - Intronic
1064808775 10:19168660-19168682 CATATTAACTAGTTTGTAGATGG + Intronic
1064847405 10:19670680-19670702 ATAAGTAACTAGGTTGTTGGTGG - Intronic
1066128998 10:32371969-32371991 AATATTAAATAGGATGTTCAGGG - Intronic
1066506023 10:36044723-36044745 AACCTTAACTAGATTGATGAGGG - Intergenic
1067672447 10:48335229-48335251 ATGATTAACTAGAATTTTGATGG - Intronic
1068423994 10:56832814-56832836 AAGATTAAATAACTTGTTAAGGG - Intergenic
1069101865 10:64332083-64332105 AAGTTTACCTAAGTTTTTGAGGG + Intergenic
1071176792 10:82935837-82935859 AAGATTCAATATGTTGTTGCAGG - Intronic
1071290189 10:84183255-84183277 AAGGTTAAGTAACTTGTTGAAGG + Intronic
1071970172 10:90897333-90897355 ATGAATAGCTAGGTTATTGAGGG + Intronic
1073907286 10:108297158-108297180 AAGATAAACTATGTTATTGCTGG + Intergenic
1074571625 10:114629688-114629710 AAGGGTAAGTAGGTTGCTGAAGG - Intronic
1075758485 10:124836208-124836230 AAGAATAAGGAAGTTGTTGAAGG + Exonic
1075939432 10:126376989-126377011 AAGATTACATAGTTTGTTCAAGG + Intronic
1075968688 10:126634757-126634779 AAAATTAATTAAGTTGTTCATGG + Intronic
1082116440 11:48334645-48334667 AAGATTAATTATGGTGTTCAAGG - Intergenic
1086051708 11:82599787-82599809 AAGGTGAACTAGCTTGTTCAAGG + Intergenic
1086251111 11:84815433-84815455 AAGATTCCCCAGGTTGGTGATGG - Intronic
1086377849 11:86219280-86219302 AAGTTGAATTAAGTTGTTGAGGG + Intergenic
1086862128 11:91936990-91937012 AAGAATGACTAGGATGTTGAAGG - Intergenic
1091864913 12:3824556-3824578 AAGATACAATAGGGTGTTGAAGG - Intronic
1092481123 12:8860009-8860031 AAGATTAAATAGCTTGCTCACGG - Intronic
1093037133 12:14342700-14342722 AAGGTTTACTAGGATGCTGAAGG - Intergenic
1093109488 12:15132143-15132165 AAGATGAACTAGGAGGATGAAGG + Intronic
1093413403 12:18893765-18893787 AAAATTAACAAGGTTATTCAGGG - Intergenic
1098282328 12:68874202-68874224 AAGATATAATAGGTTTTTGAAGG + Intronic
1098708028 12:73716189-73716211 AAGATTAAATAATTTGATGAAGG - Intergenic
1100796590 12:98188338-98188360 AAGACTAACTATGATGCTGAAGG + Intergenic
1101544548 12:105699345-105699367 AAGATTGCCTTGGTTGTTGGGGG - Intergenic
1104730040 12:131100047-131100069 AAGATAAAGTTGGTTGATGATGG + Intronic
1106569823 13:30916623-30916645 AAAATTAACTAACTTCTTGAAGG + Intronic
1107284143 13:38770885-38770907 AAGATTGAATAGCTTTTTGAGGG + Intronic
1108410079 13:50136840-50136862 AAAATTAAATAGCTTGTTCAAGG + Intronic
1110082272 13:71330297-71330319 AGGATTAAATAGCTTGTTTAAGG + Intergenic
1110137967 13:72091560-72091582 AAGACTGATTAGGTTGCTGAAGG - Intergenic
1112702282 13:102023902-102023924 AAGATAAACAAGAATGTTGAAGG + Intronic
1113267740 13:108638085-108638107 AATTTTAAATAGGTTGTTAAGGG + Intronic
1114649338 14:24274033-24274055 AAGATTAAGTAACTTGTTGAGGG + Intergenic
1116367920 14:44091544-44091566 AAGATTGACTATGTGGATGAAGG + Intergenic
1117619158 14:57566542-57566564 AACATTCACCAGGATGTTGAAGG + Exonic
1118062838 14:62159774-62159796 AAGAATGACTGGGTTGTTCAGGG + Intergenic
1120870479 14:89332433-89332455 AAAATTATATAGGGTGTTGATGG - Intronic
1121636879 14:95459945-95459967 AAGATTAGCTGGGTTTGTGAAGG + Intronic
1124616156 15:31243685-31243707 AAAAGTAACCAGGTTTTTGAGGG - Intergenic
1125091107 15:35793857-35793879 AAACTCAACTAGGATGTTGAGGG - Intergenic
1125172070 15:36777098-36777120 ACCATTATCTTGGTTGTTGATGG + Intronic
1127272289 15:57412610-57412632 AAGATAAACTAGGCTGTTTCAGG - Intronic
1127951832 15:63815378-63815400 AAGATTAAGTAAATTGTTCAAGG - Intronic
1129482758 15:75841374-75841396 CAGATTAAATAGCTTGTTTAGGG + Intergenic
1133580381 16:7138952-7138974 AAAATTAACTAGGTGGTAGGAGG - Intronic
1135937841 16:26796220-26796242 GAGAATAACTAGGTAGTTCAGGG + Intergenic
1136058514 16:27708606-27708628 AAGGTTAACTAACTTTTTGAAGG + Intronic
1138047676 16:53742799-53742821 AAGATTAACTAGGTTGTTGAAGG + Intronic
1146931253 17:36779757-36779779 AAGCATAAATAGGTTGCTGAGGG + Intergenic
1147158167 17:38555616-38555638 GAGATTAACTAGTTAGTTCAAGG + Intronic
1149614108 17:57983521-57983543 TAGAGTAACTAGGTGGTTGCTGG - Intronic
1159554278 18:69928991-69929013 AAGATTAACCACGTAGGTGAGGG + Intronic
1159814263 18:73053553-73053575 GAGACCAACTAGGTTCTTGATGG - Intergenic
1160356803 18:78234599-78234621 AAGATGAACTACTTTCTTGAAGG + Intergenic
1161718743 19:5891997-5892019 AACATTTACTAGGTTGTGGAGGG - Exonic
925216314 2:2098666-2098688 AAGGTTAACTGGGAAGTTGATGG - Intronic
926843695 2:17110053-17110075 AAGGTTAACTAGGCTGAGGATGG + Intergenic
926935605 2:18084370-18084392 TAGAGTAGCTAGGTTGTTTATGG + Intronic
927448801 2:23188934-23188956 AAGATTAAATGGGTTGGTCATGG - Intergenic
927573846 2:24183980-24184002 AAGATAAACTATATTGTTTAAGG - Intronic
927706879 2:25301877-25301899 AAAGTTGAGTAGGTTGTTGAGGG - Intronic
928918232 2:36497595-36497617 AAGAATACCTTGGTTATTGAAGG + Intronic
931950024 2:67351817-67351839 AAGATTAACTAAGTTGGACAAGG + Intergenic
931996978 2:67848076-67848098 AAGATTAACTACCTCTTTGAAGG + Intergenic
935327372 2:101948972-101948994 AAGAGGAAGTAGGTTGTTGGTGG - Intergenic
937480701 2:122255751-122255773 AAGAATAACAATGTTGTTGGTGG - Intergenic
937729421 2:125209699-125209721 AAGATTAAAGAGGTTTTTAAGGG - Intergenic
938887428 2:135666205-135666227 AAGAGTAACTAGGGTGTAAAAGG + Intronic
938995459 2:136673165-136673187 GAGATTAAATAAGTTGTTGACGG - Intergenic
939461491 2:142502115-142502137 AAGATTAAGTAGCTTATTCAAGG + Intergenic
940421539 2:153484817-153484839 AAGATCAACTAGGATGGGGATGG + Intergenic
942022507 2:171880932-171880954 AAGGTTAAGTAGCTTGTTCAAGG - Intronic
942462816 2:176180383-176180405 AAGATTAAGTGGGTTGCTTAGGG - Intergenic
945460197 2:210098698-210098720 AAGATTAAGTAGCTTGATCAAGG + Intronic
945540566 2:211081335-211081357 TAGAGTAACTAGGGTGTTCAAGG + Intergenic
945613931 2:212043769-212043791 AAGATTAAATAACTTGTTCAAGG - Intronic
946052114 2:216871795-216871817 AAGATTTACTATGATGTTCATGG + Intergenic
946718016 2:222573646-222573668 AAGATTATATAAGGTGTTGATGG + Intronic
1169636464 20:7697523-7697545 AAAATTAAATAGTTTGCTGACGG + Intergenic
1172851718 20:37971156-37971178 AAGGGTAACTAGGATGTGGAAGG + Intergenic
1174547464 20:51336320-51336342 TAGATTAACTTGTTTGTTTATGG + Intergenic
1179013048 21:37571233-37571255 AAGATTATCCAGGTTGAAGAAGG - Intergenic
1181829673 22:25550177-25550199 AACATTGACTTGGTTGGTGACGG - Intergenic
1182972033 22:34588298-34588320 AAGCCGAACTAGGATGTTGAAGG + Intergenic
950830995 3:15876242-15876264 AAGATGAACGAAATTGTTGATGG - Intergenic
951092476 3:18590326-18590348 AAAATTAAATAGTTTGTTCAAGG - Intergenic
953528855 3:43720086-43720108 CAGATTAACTAGGTTAGTGCAGG + Intronic
958270725 3:91496074-91496096 AAGTTTATTAAGGTTGTTGAAGG + Intergenic
961088864 3:124092724-124092746 AAGATTAAATAACTTGTTTAAGG - Intronic
962126824 3:132628489-132628511 AAGATTGATTGGATTGTTGAAGG - Intronic
962674586 3:137745497-137745519 AAGATTAACAAGATTGTTATTGG + Intergenic
962696864 3:137957932-137957954 AGGAGTAACTAAGTAGTTGAGGG - Intergenic
963308971 3:143687378-143687400 AAGATTAACTAGGTGTTTTAAGG + Intronic
964629227 3:158791644-158791666 AAAATTAACTAACCTGTTGAAGG - Intronic
965279690 3:166734192-166734214 AAGATTAAATAGGATTTTGAAGG - Intergenic
967494477 3:190127582-190127604 GAGATTAAGTAGAATGTTGAAGG - Intergenic
969555308 4:7904606-7904628 AAGATTAAGTAAGTTGTCCATGG + Intronic
970124571 4:12794297-12794319 AAAATTAAATAAGTTGTTCAAGG - Intergenic
971897859 4:32620391-32620413 AAGATTAAGTAAGTTGTCCAAGG - Intergenic
972378962 4:38501064-38501086 AAACCTATCTAGGTTGTTGAGGG - Intergenic
972866040 4:43233898-43233920 TAACTTAACTAGGTTGGTGAGGG + Intergenic
973764688 4:54152372-54152394 AAGTTTAACTAGGGTGGTCAGGG + Intronic
973928370 4:55763525-55763547 AAGAATAACGACGCTGTTGATGG - Intergenic
974928501 4:68332279-68332301 AAGTTTAGCTGGGTTGTGGAGGG - Intronic
976210746 4:82667053-82667075 AATATTAACTTAATTGTTGATGG - Intronic
976657963 4:87509337-87509359 AAGATTAAGTAACTTGTTCAGGG + Intronic
978160709 4:105544653-105544675 AAGATTTTCAAGGTTGTTGGGGG - Intergenic
979428299 4:120595116-120595138 AAGATTAAATAGGTTTTTAATGG + Intergenic
980450916 4:132970661-132970683 AAGATTTACTTGGTTTGTGAGGG - Intergenic
980561887 4:134488413-134488435 AAGATTAACTTGATTTCTGAGGG + Intergenic
981736404 4:147956980-147957002 AAGTTTAAAGAGTTTGTTGAAGG + Intronic
982798839 4:159676984-159677006 GAGATTAAATAAGTTGTTCAAGG - Intergenic
984010910 4:174370502-174370524 AATATTTACTAGGTTGCAGAAGG + Intergenic
984615394 4:181891341-181891363 TAGATTAACTGGGTTGTTTAGGG - Intergenic
986426586 5:7637709-7637731 AAGTTTAACTATGTTTTAGAAGG + Intronic
987546770 5:19320468-19320490 AAAAGTAACTAGGTTTTTAAAGG - Intergenic
987711731 5:21509470-21509492 AAGATTAAACAACTTGTTGAGGG - Intergenic
988725765 5:33924947-33924969 AAGTTTATCAATGTTGTTGATGG - Intergenic
989140055 5:38193077-38193099 GAGGTTATGTAGGTTGTTGAAGG + Intergenic
990227336 5:53669387-53669409 AGTATTAACGAGGTTGTAGAGGG - Intronic
990358503 5:54995145-54995167 AAGATTAAGCAGGTGGATGAAGG - Intronic
991193688 5:63906343-63906365 GAAAATAACTAGGATGTTGACGG - Intergenic
991762097 5:69928596-69928618 AAGATTAAACAACTTGTTGAGGG - Intergenic
991785231 5:70189504-70189526 AAGATTAAACAACTTGTTGAGGG + Intergenic
991841325 5:70803645-70803667 AAGATTAAACAACTTGTTGAGGG - Intergenic
991877677 5:71189907-71189929 AAGATTAAACAACTTGTTGAGGG + Intergenic
994145801 5:96393565-96393587 GAGATTAAAAAGGTTGTTAAAGG - Intronic
996013954 5:118510284-118510306 AATATTATCTAGATTGTTTAGGG - Intergenic
996990051 5:129618512-129618534 AAAATTAAATATGTTTTTGAAGG - Intronic
998994714 5:147858605-147858627 AAGATTATCCAGGCTTTTGAAGG - Intergenic
999777325 5:154821642-154821664 AAGATTAAAAAGGTTGTTGGAGG + Intronic
999896309 5:156037603-156037625 TAGATTAGGTAGCTTGTTGATGG + Intronic
1000377779 5:160599449-160599471 AAGATTAAGTAGTTTGTCCAAGG - Intronic
1000618718 5:163459574-163459596 CAGATTAACTAGGTTGCTAAAGG - Intronic
1000668039 5:164023259-164023281 AAATTTAACTAGATTGATGATGG - Intergenic
1002205155 5:177557582-177557604 ATGATTTACTCTGTTGTTGAGGG + Intergenic
1004778934 6:18883028-18883050 TAGATTAAATAGGGTGTTTATGG + Intergenic
1006960440 6:37924833-37924855 AAAATAAATTGGGTTGTTGAGGG + Intronic
1008984420 6:57525259-57525281 AAGTTTATTAAGGTTGTTGAAGG - Intronic
1009005968 6:57787216-57787238 AAGATTAAACAACTTGTTGAGGG + Intergenic
1009438615 6:63648390-63648412 AATATTAACATGGTTGTTGCTGG + Intronic
1009796063 6:68469683-68469705 AAGGTTAACTATGTAGTTTAAGG + Intergenic
1010777287 6:79901833-79901855 AAGATTAAGTAACTTGTTCAAGG + Intergenic
1011237290 6:85231463-85231485 AAGATTAAATAGCTTGTTCAAGG - Intergenic
1011795243 6:90945945-90945967 AAGGTTAAGTAGCTTGTTCAAGG + Intergenic
1012082811 6:94783006-94783028 AAAATTAACAAGGTTATTTAGGG - Intergenic
1014783339 6:125589533-125589555 AAGTATAAATAGGTTGATGAAGG - Intergenic
1015418864 6:132983250-132983272 TCGATAAACTAGGTTATTGATGG - Intergenic
1015446598 6:133312709-133312731 AACATTTACTTTGTTGTTGAGGG - Intronic
1016157050 6:140823495-140823517 AAGAATAACTAGGATGTTCTGGG + Intergenic
1016407039 6:143741753-143741775 CAGATTCTCTAGGTTTTTGAGGG - Intronic
1016547576 6:145241547-145241569 AATATTAACTAAGTCGTTGATGG + Intergenic
1020534211 7:9373608-9373630 AAGGTTGACTAGTTTATTGAAGG - Intergenic
1022820714 7:33957834-33957856 TTGATTAACTAGGGTGTTCACGG - Intronic
1024192364 7:47025668-47025690 AAGATTAACTAAGCCGTTTAGGG - Intergenic
1024855571 7:53774565-53774587 AAGATGAACCAGGCTGTGGAGGG + Intergenic
1024856551 7:53787774-53787796 AAGATTATTTAAGTTATTGAGGG - Intergenic
1027526178 7:79271501-79271523 AAAGCTAACTATGTTGTTGAAGG - Intronic
1028474850 7:91241767-91241789 AAGATAAAATTGGTAGTTGAGGG - Intergenic
1030078038 7:105753455-105753477 AAGATTATCTAGTTTATAGATGG + Intronic
1032265972 7:130370245-130370267 AAGATGATCTGGGTTGTTCAGGG - Intergenic
1032351692 7:131170312-131170334 AAGATTAAGTAACTTGTTCAAGG + Intronic
1035013178 7:155739078-155739100 AATATTATCTAGGGTGTTAAAGG + Intronic
1038664611 8:29527409-29527431 AAGATTACCTAGGTACTTCATGG + Intergenic
1038732763 8:30141949-30141971 AATGTTAACTGGGGTGTTGAGGG - Intronic
1038827054 8:31015398-31015420 AAGATTAACTAGATTGACTAAGG + Intronic
1039298866 8:36187519-36187541 AAGATTAAATACCTTGTTCAAGG - Intergenic
1042425726 8:68645750-68645772 TACATTAACTAGGTCGTTGATGG - Intronic
1045372153 8:101535168-101535190 AAGGTTAACTAAGTTGTCCAGGG - Intronic
1046862246 8:119106560-119106582 ATGATTAGGAAGGTTGTTGATGG + Exonic
1047624240 8:126639658-126639680 AAGATTAAGTAAGTTGTCCAAGG - Intergenic
1048320805 8:133398825-133398847 AAGATGAACTGGCTTATTGAGGG - Intergenic
1048803319 8:138215178-138215200 AAGATTAGGTAGATTGTGGATGG - Intronic
1051540556 9:18211883-18211905 TAGCTTAACTGGGTTGTTGAGGG - Intergenic
1051599125 9:18854475-18854497 AAGAGGAACCAGGTAGTTGAGGG + Intronic
1054949083 9:70829229-70829251 AAGATTGAGTAGTTTGTTAAAGG + Intronic
1055270083 9:74548049-74548071 AAGAACAAATAGGTTGCTGATGG + Intronic
1055562194 9:77532155-77532177 AAGATTAAATTGGTTGTCCAAGG + Intronic
1055984188 9:82039443-82039465 AAAATTTACTTGGTTATTGAGGG + Intergenic
1059090055 9:111346913-111346935 AAGATCAACAAGGATGTAGAAGG + Intergenic
1189255805 X:39638090-39638112 AAGAGTAACTGGTTTGTTGGTGG + Intergenic
1192808152 X:74528056-74528078 AAGATTTTCTATGTTGTTGCTGG - Intronic
1194697717 X:97075955-97075977 AAGATTAAACAGTTTGTTCATGG - Intronic
1196559886 X:117133173-117133195 AAGATTAAGCTGGTTCTTGAAGG - Intergenic
1196824397 X:119729792-119729814 ATAATTAACTAGGATGATGAAGG - Intergenic
1197146937 X:123182326-123182348 CAGATTAACAAAGTTGTTCAAGG + Intergenic
1201778609 Y:17694130-17694152 GATATTAACTAGTTAGTTGATGG + Intergenic
1201822947 Y:18211862-18211884 GATATTAACTAGTTAGTTGATGG - Intergenic