ID: 1138053883

View in Genome Browser
Species Human (GRCh38)
Location 16:53812188-53812210
Sequence CTCTGGTTGTAGAGGTGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 147}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138053883 Original CRISPR CTCTGGTTGTAGAGGTGTCA GGG (reversed) Intronic
900157973 1:1211172-1211194 CTCTGGCTGGAGAGGGGTCTTGG - Intergenic
901090493 1:6637637-6637659 CTCGGGTAGCAGAGCTGTCAGGG - Intronic
901370608 1:8794456-8794478 CTGTGATTGTTGAGGTGGCAGGG + Intronic
902515620 1:16987983-16988005 GTGTGGTTGGAGAGGTGGCAAGG - Intronic
902847038 1:19119563-19119585 CTCTGTTTGTGGAGTTTTCAGGG + Exonic
902953156 1:19903649-19903671 CCCAGGTTGTAAAGGTCTCATGG + Intronic
903852834 1:26318477-26318499 CTGTGGTTATGGAGGTGACAGGG + Intronic
904712828 1:32443852-32443874 CTCTGGTTGATGAAATGTCAGGG + Intergenic
906785975 1:48616304-48616326 CTCTGGTTGTAGAGGCCTCCTGG - Intronic
910705768 1:90128258-90128280 CTCTCATTGTAGAGGAGACAGGG - Intergenic
915088732 1:153406525-153406547 TTCTGGGTGTGCAGGTGTCAGGG - Intergenic
915164201 1:153939551-153939573 CTCTGCTTGGAGATGTATCATGG - Intronic
915598345 1:156907829-156907851 CTGTGGTTATGGGGGTGTCAAGG + Intronic
917534320 1:175863454-175863476 CTCTGTCTGCAGAGGTATCAAGG - Intergenic
918114528 1:181484903-181484925 CTCTGATGGTGGTGGTGTCAGGG + Intronic
1063961138 10:11306208-11306230 CTCTGCTTGAAGAGGTGTTCTGG + Intronic
1067945852 10:50687473-50687495 CCCTGAATGTAGAGGAGTCACGG - Intergenic
1068675708 10:59767355-59767377 CTCTGGTTGATGAAATGTCAGGG + Intergenic
1070273071 10:74976665-74976687 CTGTGGCTGCAGAGGTGACATGG - Intronic
1070755467 10:78989410-78989432 GTCTGGTTGGAGAGGAATCAAGG - Intergenic
1070867368 10:79714348-79714370 CCCTGAATGTAGAGGAGTCACGG - Intronic
1070881160 10:79852472-79852494 CCCTGAATGTAGAGGAGTCACGG - Intergenic
1071288325 10:84169441-84169463 CTCTGGTTGATGAAGTGCCAGGG + Intergenic
1072612074 10:97024195-97024217 ATCAGGTTGTACAGGTCTCAAGG - Intronic
1074253744 10:111779851-111779873 CTCTGGTCCTGTAGGTGTCAGGG - Intergenic
1081227344 11:40540559-40540581 CTCTGCAGGTGGAGGTGTCAGGG - Intronic
1083323594 11:61862398-61862420 CTCTGGCTGGACTGGTGTCAGGG - Intronic
1084219403 11:67668021-67668043 GTCTGGGTGTAGGGGTGGCAAGG - Intronic
1085248910 11:75128561-75128583 GTCTGGTTCTACAGATGTCATGG + Intronic
1086036660 11:82424155-82424177 TTCTGGTTCTAGAAATGTCAAGG + Intergenic
1088108239 11:106229307-106229329 CTCTGGTTGATGAAATGTCAAGG - Intergenic
1093210676 12:16304569-16304591 CTCTGCTTTTGGAGGTCTCAGGG - Intergenic
1094447307 12:30545911-30545933 CTGTGCTGGTAGAGGTGGCAGGG + Intergenic
1098650939 12:72967657-72967679 CTCTGGTTTTAGGGGTATCCAGG + Intergenic
1099735765 12:86564906-86564928 CAATGGTTCTTGAGGTGTCAGGG + Intronic
1101697800 12:107142719-107142741 CTCAGGTTGTAGATGAGTTAAGG - Intergenic
1103338278 12:120206599-120206621 CTCTGATTGTAAAGGTGTCCAGG - Intergenic
1103425740 12:120831819-120831841 CTTTGGTGGTAGTGGTGTGAGGG - Intronic
1105737582 13:23287192-23287214 CTCTGGTTATAAAGGGCTCATGG - Intronic
1110836812 13:80093127-80093149 CCCTTGCTGGAGAGGTGTCACGG + Intergenic
1111198603 13:84905376-84905398 CACTGGTTGTAGAGTTTGCATGG + Intergenic
1114007863 14:18333267-18333289 CTCAGGTTGAAGAGGGGCCAGGG + Intergenic
1119220305 14:72901035-72901057 CACTGGTTGCAGAGCTCTCATGG + Intergenic
1119221921 14:72915698-72915720 CACTGGTTGTACTGCTGTCAGGG + Intergenic
1119544910 14:75464677-75464699 ATCTGGTTGTCCAGGGGTCAAGG - Intronic
1122322802 14:100865788-100865810 CTCAGCTTGTAGAGGAATCAGGG + Intergenic
1122678551 14:103437835-103437857 CTTTCATTGTAGAGGTGACAGGG + Intronic
1125718936 15:41835924-41835946 CTCTTGTTGAAGAGGAGTCCAGG + Intronic
1126568566 15:50126129-50126151 GTGTGGGTGTGGAGGTGTCACGG + Intronic
1126968401 15:54082950-54082972 CTCCGGGTGTGGAGGTCTCAGGG + Intronic
1128839074 15:70834907-70834929 CTCTGATTTTGGAGGTGTTAGGG + Intronic
1129914170 15:79253912-79253934 CTCAGGTTGATGAGGGGTCAGGG + Intergenic
1131251152 15:90830926-90830948 CTCTGTTTTTAGATGTGTCATGG - Intergenic
1132072848 15:98794929-98794951 CTGGGGTTGGGGAGGTGTCAAGG - Intronic
1132178885 15:99736516-99736538 CTCAGGTTGTGGTGGAGTCAAGG + Intergenic
1138053883 16:53812188-53812210 CTCTGGTTGTAGAGGTGTCAGGG - Intronic
1138632999 16:58314043-58314065 CTCTGGTTAAAGACGAGTCAAGG + Intronic
1138845131 16:60555649-60555671 TTCAGGTTGTAGTGGTGTCAGGG - Intergenic
1143589799 17:7875821-7875843 CTGTGGTTGTGCAGGTTTCAGGG - Intronic
1145221248 17:21091139-21091161 CTCTGGTGATAGTGTTGTCATGG - Intergenic
1146820825 17:35982645-35982667 CTCTGTTTATGGAGGTGACAAGG + Intergenic
1147243432 17:39105615-39105637 CTCTGGTTGTTAAGGTGAAAGGG - Intronic
1150984066 17:70175471-70175493 CTATGGTTTCAGATGTGTCACGG + Exonic
1152630178 17:81407440-81407462 CCCTGGTTGCAGAAGTCTCAGGG - Intronic
1157305864 18:46517155-46517177 CTCTGGTTCTTAAGATGTCAGGG + Intronic
1159806530 18:72964032-72964054 CTCTGGTTGAACAGGGGTCCTGG + Intergenic
1163567475 19:18060008-18060030 CCCTGGTGGTAGAGATGTCCTGG - Exonic
1164513722 19:28917195-28917217 CACTGGTTGATGAGGAGTCAAGG + Intergenic
1164864207 19:31590492-31590514 CTCTGTGTGTAGGGATGTCAAGG + Intergenic
1167268652 19:48495960-48495982 CTATGGTGGTGGAGTTGTCAGGG + Intronic
1167704053 19:51067940-51067962 CTCTGGTTGAAGTGAGGTCATGG + Intergenic
929375444 2:41281486-41281508 CTGTGGTTATAGAAGTGTTAGGG + Intergenic
934095921 2:88603858-88603880 CTCTGCTTGGAGAGCTCTCATGG + Intronic
935832171 2:107011598-107011620 CTCTGGTTGTGGTGGTGATATGG + Intergenic
936166606 2:110125957-110125979 CTGTGGTTGTATAGTTTTCATGG - Intronic
936249520 2:110857114-110857136 CTCTGGTCCTTGAGGTGTCACGG - Intronic
945430228 2:209755225-209755247 ATCTGTTTGGAGAGTTGTCAGGG + Intergenic
945720378 2:213411166-213411188 CTCTGGTTGTTGAAATGCCAGGG - Intronic
946691961 2:222315989-222316011 TACTGGTAGTAGAGGTGTCCAGG + Intergenic
1169265657 20:4165851-4165873 CTCTGGTTGCTGAGGGGGCATGG + Intronic
1169585196 20:7074170-7074192 CTTTGGTTGTTGAGTTGTAAAGG + Intergenic
1169673667 20:8132008-8132030 CCCTGGTTGCAGAGGTGCTAGGG - Intergenic
1169690652 20:8327243-8327265 ATTTGGTTGTTGAGGTGTCCAGG + Intronic
1170885080 20:20333748-20333770 CTCTGGTTGCAAGGGTGGCAGGG + Intronic
1172977643 20:38918732-38918754 CCCTGGCTGGGGAGGTGTCAGGG + Exonic
1173382376 20:42557534-42557556 CTCTGGTAGCAGAGTTGTCTGGG - Intronic
1175844639 20:62051996-62052018 TTGTGGTTGTGGAGGTGACATGG - Intronic
1176144828 20:63560952-63560974 CTCTGGGTCTAGGGGTGTCAGGG - Intronic
1176339124 21:5627570-5627592 CAATGGTTGTAGATGTGTGATGG - Intergenic
1176340532 21:5690643-5690665 CAATGGTTGTAGATGTGTGATGG - Intergenic
1176472786 21:7122796-7122818 CAATGGTTGTAGATGTGTGATGG - Intergenic
1176504295 21:7633813-7633835 CAATGGTTGTAGATGTGTGATGG + Intergenic
1180432369 22:15264077-15264099 CTCAGGTTGAAGAGGGGCCAGGG + Intergenic
1180514933 22:16132015-16132037 CTCAGGTTGAAGAGGGGCCAGGG + Intergenic
1181368579 22:22398718-22398740 CTCTGTTAGTCCAGGTGTCAAGG + Intergenic
1183489484 22:38108977-38108999 CTCTGGCTGCAGAGGTGTGAGGG + Intronic
949469918 3:4383487-4383509 CTCTGGTCGTGGTGGTGGCACGG + Intronic
956029622 3:65023655-65023677 CTCTGGTTCCAGAGCTGTAAAGG + Intergenic
958594196 3:96201071-96201093 CTGTGCTTGTTGAGGTGTAATGG - Intergenic
961065892 3:123877193-123877215 GTCTGGTTGTAGTGGGATCAAGG + Intronic
961486811 3:127222492-127222514 CTCTGGTTGCAGTGGGGTGAGGG + Intergenic
961577985 3:127854114-127854136 CTCTGGCAGTAGAGGTGACAAGG + Intergenic
967226150 3:187293303-187293325 CTGTGCTTGTAGAAGTGTCCAGG + Intergenic
968973950 4:3811422-3811444 CTTTGGCTGGAGGGGTGTCATGG + Intergenic
969470927 4:7388886-7388908 CTCTGGTTGTTGTGGTGTTGTGG + Intronic
970471514 4:16384075-16384097 ATCTGGTTGTAAAGGGGCCAGGG + Intergenic
971318343 4:25585641-25585663 CTCTGGAGGTAGAGGTTGCAGGG - Intergenic
973658070 4:53072053-53072075 CTCTAGTTGTAAAGTTGTTATGG - Intronic
978809375 4:112833337-112833359 ATCTGATTTTAGAGATGTCAGGG + Intronic
982423316 4:155223804-155223826 CTCTGGTAGTTTTGGTGTCATGG - Intergenic
984933426 4:184868492-184868514 ATCAGGTTGTAAAGTTGTCATGG + Intergenic
986281773 5:6329251-6329273 CACAGGTTGTAGAGGTAGCATGG - Intergenic
988959477 5:36355345-36355367 CTCTGGTTTTTGAGGTGCAATGG - Intergenic
992996313 5:82337406-82337428 ATGTGGTTGGAGAAGTGTCATGG + Intronic
993169325 5:84397033-84397055 TGCTGGTTGTAGAAGTGCCAGGG - Intergenic
994116590 5:96068028-96068050 CTCTGGGAATAAAGGTGTCAGGG + Intergenic
1001115444 5:168935432-168935454 CTCTGGTTGTAGAGATAAGATGG - Intronic
1002682798 5:180981495-180981517 CTCTGGTGATAAAGGCGTCAAGG + Intergenic
1006730073 6:36230152-36230174 CTCTGTTTGGAGAGTTGTAAGGG - Intronic
1008306870 6:49913944-49913966 CTCTGGTTGAGGGGTTGTCACGG - Intergenic
1010634114 6:78235323-78235345 CTGTGATTCTAGAGGTGACAAGG - Intergenic
1015467846 6:133567631-133567653 CTCTGGGTGTGGCAGTGTCATGG - Intergenic
1016708889 6:147146123-147146145 CTCAGGTGGTATAGGTGCCAGGG - Intergenic
1017013335 6:150079914-150079936 CTCTGGTTGTAAAGGAGTCTGGG + Intergenic
1018143043 6:160858819-160858841 CTCTGGTTGGTGGGGTGGCAGGG - Intergenic
1018423862 6:163662979-163663001 CTCTGGTTGCAGGGGTGACATGG + Intergenic
1024786428 7:52912180-52912202 GACTGGTTGTGGTGGTGTCATGG - Intergenic
1029510661 7:100992825-100992847 CTGAGGTTGTGGAGCTGTCAGGG - Exonic
1029511150 7:100996074-100996096 CTGAGGTTGTGGAGCTGTCAGGG - Exonic
1029511878 7:101000745-101000767 CTGAGGTTGTGGAGCTGTCAGGG - Exonic
1029512370 7:101003994-101004016 CTGAGGTTGTGGAGCTGTCAGGG - Exonic
1029958151 7:104661122-104661144 CTCTGGGTCCAGAGATGTCATGG - Intronic
1031417349 7:121509703-121509725 CTCTGGTGGTAGAGGGGAAAGGG + Intergenic
1031555447 7:123169776-123169798 CTCTGTTCATAGGGGTGTCAAGG + Intronic
1040418867 8:47220730-47220752 CTCAGATCTTAGAGGTGTCAGGG + Intergenic
1040590699 8:48789749-48789771 CTCTGGATGGGGTGGTGTCAGGG + Intergenic
1041096253 8:54353515-54353537 CTCTCCTTGGAGTGGTGTCATGG + Intergenic
1044268561 8:90212230-90212252 TTCAGATAGTAGAGGTGTCAGGG - Intergenic
1046604103 8:116351541-116351563 CTGTGGTTGAAGAGGTGGCGAGG - Intergenic
1047500016 8:125433127-125433149 TACTGGTTTTAAAGGTGTCAGGG + Intronic
1049236875 8:141516701-141516723 CTCTGCTTGTAGAGGGGTCGAGG - Intronic
1051109503 9:13619759-13619781 CACTGGTGGTATAGATGTCATGG - Intergenic
1051806315 9:20996565-20996587 CTCTGGATAGAGAGGTGTCAAGG + Intergenic
1057353086 9:94316589-94316611 CCCTGAATGTAGAGGAGTCACGG + Intergenic
1057654659 9:96941002-96941024 CCCTGAATGTAGAGGAGTCACGG - Intronic
1062287343 9:135779028-135779050 CTGTGGTTGTGGGGGTTTCAGGG - Intronic
1203422535 Un_GL000195v1:7350-7372 CAATGGTTGTAGATGTGTGATGG + Intergenic
1187794802 X:22992065-22992087 ATGGGGTTGTAGAGGTGTAAAGG - Intergenic
1187916040 X:24152652-24152674 CTGTGGTTGTTGAGGTGTTAAGG + Intronic
1189833724 X:45000421-45000443 CTCTGGTTGATGAAGTGCCAGGG + Intronic
1190281884 X:48936578-48936600 ATCTGGTGATAGAGGTGTCCTGG - Intronic
1194290257 X:92063626-92063648 CTCTGGTTTTCGAGTTGCCATGG + Intronic
1195565832 X:106338386-106338408 CTCTGGTTAAAGAAGAGTCAAGG - Intergenic
1197664559 X:129210129-129210151 CTGTTCTGGTAGAGGTGTCAGGG + Intergenic
1198087091 X:133292112-133292134 CTCTGGTTCCAGAGTTGACAGGG - Intergenic
1198402204 X:136279013-136279035 GTATGAATGTAGAGGTGTCATGG - Intergenic
1198743926 X:139870124-139870146 CTTTAGTTGTAGTGGTTTCATGG + Intronic
1199391197 X:147281278-147281300 CTTTGGTTTTAGAGGTGAAAAGG - Intergenic
1199391416 X:147283976-147283998 CTTTGGTTTTAGAGGTGAAAAGG - Intergenic
1199391634 X:147286675-147286697 CTTTGGTTTTAGAGGTGAAAAGG - Intergenic
1201318358 Y:12670484-12670506 CTCTGGTTAAAGAAGAGTCAAGG - Intergenic