ID: 1138056662

View in Genome Browser
Species Human (GRCh38)
Location 16:53841540-53841562
Sequence CCAAGTTCATGGTCTCTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 621
Summary {0: 1, 1: 0, 2: 4, 3: 54, 4: 562}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138056662 Original CRISPR CCAAGTTCATGGTCTCTGCA AGG (reversed) Intronic
900724629 1:4207964-4207986 CCGAGTACATGGTCCCTGCACGG - Intergenic
901462549 1:9400282-9400304 CCAGCTTCATGGGGTCTGCAGGG + Intergenic
901759171 1:11459539-11459561 CCAAGCTCAAGGTGTCAGCAGGG + Intergenic
902227972 1:15008704-15008726 CCAAGTTCAAGGTCTGTGTAAGG + Intronic
902836163 1:19048015-19048037 CAAACTTCACAGTCTCTGCAAGG + Intergenic
903068858 1:20716846-20716868 GCAAGCTCATGAGCTCTGCAAGG - Intronic
903289041 1:22296277-22296299 CCAAGGTCAAGGTGTCAGCATGG + Intergenic
904007903 1:27373455-27373477 CCAAGTTCCTGGCTCCTGCAAGG + Intronic
905003908 1:34695173-34695195 CCAAGATCAAGGTGTCGGCAGGG + Intergenic
905316259 1:37083341-37083363 CCAAGGTCAAGGTGTCAGCAGGG - Intergenic
907732816 1:57084386-57084408 CCCAGATCAAGGTGTCTGCAGGG - Intronic
908465171 1:64386427-64386449 ACAAGATCATGCTCTTTGCAGGG - Intergenic
909140839 1:71863278-71863300 ACAAGATCATGTCCTCTGCAGGG + Intronic
909919842 1:81367531-81367553 ACAAGGTCATGTTCTTTGCAGGG - Intronic
911293259 1:96083076-96083098 CCAATTACAAGGTGTCTGCAGGG - Intergenic
911892101 1:103384352-103384374 ACAAGATCATGTTCTTTGCAGGG - Intergenic
911901139 1:103507070-103507092 CTAAGATCAGGGTCTCTGAAGGG - Intergenic
912052260 1:105544146-105544168 CCAAGATCAAGGTGTCAGCAGGG + Intergenic
916243998 1:162668479-162668501 CCAAGATCAAGGTGTCAGCAGGG + Intronic
916723480 1:167502901-167502923 CCAAAGTCAAGGTGTCTGCAGGG - Intronic
916738085 1:167626004-167626026 CCAATTTCCTGATCTCTGCAGGG + Intergenic
917119341 1:171632067-171632089 CCAAGATCAAGGTGTCAGCAGGG - Intergenic
917697573 1:177542269-177542291 ACAAGATCATGTTCTTTGCAGGG + Intergenic
918340429 1:183563860-183563882 CCTAGCTCATGGACTCTGTAAGG + Intronic
918920956 1:190709052-190709074 CCAAGATCAGGGTGTCTGCATGG + Intergenic
919662129 1:200257502-200257524 CCAAGATCAAGGTGTCGGCAGGG - Intergenic
920223148 1:204419076-204419098 CCAAAATCAAGGTGTCTGCAAGG - Intergenic
920740767 1:208579249-208579271 CCAAGATCAAGGTGTCAGCAAGG - Intergenic
920828739 1:209446798-209446820 CCAAGATCATGTCCTTTGCAGGG + Intergenic
920950812 1:210570294-210570316 CCAGGATCATGGTCTGGGCAGGG - Intronic
921121560 1:212141791-212141813 ACGAGTTCATGCTCTCTGCAAGG - Intergenic
921770244 1:219028180-219028202 CCAAGATCAAGGTGTCGGCAGGG + Intergenic
922030806 1:221795700-221795722 CCAAGCCCATATTCTCTGCATGG + Intergenic
922163330 1:223094483-223094505 CCAAGATCAAGGTGTCAGCAGGG + Intergenic
922561715 1:226574603-226574625 CCAAATTCATGGCCTGAGCATGG + Intronic
922916311 1:229260447-229260469 CCAAGGTCAAGGTGTCAGCAGGG - Intergenic
923036572 1:230288714-230288736 CCAGGATCAAGGTGTCTGCAGGG - Intergenic
923057418 1:230437455-230437477 CTAACTTCAAGGTGTCTGCAGGG + Intergenic
923914971 1:238491893-238491915 CCACATCCATGGGCTCTGCAAGG + Intergenic
924828506 1:247567488-247567510 ATAAGTTTATGGTCTTTGCAGGG - Intronic
1062889071 10:1043517-1043539 CCACATGCATAGTCTCTGCATGG + Intronic
1062961158 10:1574550-1574572 CCAAGGTCAAGGTGTCGGCAGGG + Intronic
1063109616 10:3023383-3023405 ACAAGATCATGTTCTTTGCAGGG - Intergenic
1063184103 10:3634815-3634837 ACAAGGTCATGTTCTTTGCAGGG - Intergenic
1063232140 10:4075695-4075717 CCAAGATCAAGGTGTCAGCAGGG - Intergenic
1063820152 10:9825394-9825416 CCATGTTCCTGGTCTAGGCATGG + Intergenic
1063898966 10:10712194-10712216 GCAAGTTCATGGCCTTTGAATGG + Intergenic
1063972588 10:11391701-11391723 CCAAGGTCAAGGTGTCGGCAGGG + Intergenic
1064074805 10:12260182-12260204 CCAAGATCAGGGTGTCGGCAGGG - Intergenic
1064331938 10:14402228-14402250 ACAAGTTCATGTTCTTTGCAGGG - Intronic
1064602275 10:17006058-17006080 CCAAGGTCAAGGTGTCGGCAGGG - Intronic
1064713856 10:18154893-18154915 CCAAGGTCAAGGTGTCAGCAGGG - Intronic
1065781889 10:29176667-29176689 ACGAGATCATGTTCTCTGCAGGG + Intergenic
1066294660 10:34043603-34043625 CCAAGGGCATGCTGTCTGCATGG + Intergenic
1067213081 10:44278038-44278060 CCGAGTTCATGTCCTTTGCAGGG + Intergenic
1067219946 10:44336811-44336833 CCAAGATCAGGGTGTCAGCAGGG - Intergenic
1067524474 10:47029789-47029811 CCAAGATCAGGGTGTCGGCAGGG + Intergenic
1069337176 10:67366036-67366058 CTAAGTTCATGTCCTTTGCAGGG + Intronic
1070233164 10:74594016-74594038 TCCAGTTCATGTTCTTTGCATGG + Intronic
1070263351 10:74879215-74879237 CCAAGTTCAGGGTCTTTTCTGGG + Intronic
1070671844 10:78382989-78383011 CCAAGGTGATGGTTTCAGCAAGG - Intergenic
1071025414 10:81107237-81107259 CCAAGATCAAGGTTTCAGCAGGG - Intergenic
1071045464 10:81369583-81369605 ACAAGATCATGTTCTTTGCAGGG - Intergenic
1071214030 10:83378103-83378125 ACAAGATCATGTTCTTTGCAGGG + Intergenic
1071568716 10:86684893-86684915 CCCAGAGCATGGTCTCTGTAGGG - Intronic
1071881720 10:89906105-89906127 ACAAGATCATGTTCTTTGCAGGG - Intergenic
1072573771 10:96681078-96681100 CCAAGATCAAGGTGTCAGCAGGG + Intronic
1073493100 10:103867977-103867999 CCAAGATCAAGGTGTCAGCAGGG - Intergenic
1073680905 10:105702421-105702443 CCAAGTATAAGGTCACTGCACGG - Intergenic
1073852791 10:107640644-107640666 CCAAGATCAAGGTGTCAGCAGGG + Intergenic
1073962316 10:108946675-108946697 ACAAGATCATGTCCTCTGCAGGG + Intergenic
1074358398 10:112805832-112805854 CCAAGGTCAAGGTGTCGGCAGGG - Intronic
1074433800 10:113416550-113416572 CCAAGGTGCTGGCCTCTGCATGG + Intergenic
1074926071 10:118073024-118073046 CCAAGTTCAAGGTGCCAGCAGGG + Intergenic
1075021817 10:118957674-118957696 CCAAAATCAAGGTGTCTGCAGGG - Intergenic
1075341348 10:121648884-121648906 CCAAGATCAAGGTGTCAGCAAGG + Intergenic
1075512459 10:123083595-123083617 CCAAGATCAAGGTGTCAGCAGGG - Intergenic
1075856151 10:125631862-125631884 CCAAGTTCGTCCTCCCTGCATGG - Intronic
1076186277 10:128452022-128452044 ACCAGTTCCTGGGCTCTGCATGG + Intergenic
1077810336 11:5630104-5630126 CTATGTTCATGGTCTTTACAAGG - Intronic
1078908008 11:15705300-15705322 CCAAGGTCAAGGTGTCGGCAGGG - Intergenic
1080222941 11:29927448-29927470 CCAAGATCAAGGTGTCAGCATGG - Intergenic
1081592274 11:44432595-44432617 CCAAGATCAAGGTATCAGCAGGG + Intergenic
1082207128 11:49451151-49451173 CCAAGATCAAGGTGACTGCAGGG - Intergenic
1082688373 11:56268557-56268579 ACAAGATCATGTTCTTTGCAGGG + Intergenic
1083095738 11:60249087-60249109 ACAAGTTCATGTCCTTTGCAGGG - Intergenic
1083405800 11:62456170-62456192 CCAAGATCAAGGTGTCTGCAGGG - Intronic
1084483824 11:69436794-69436816 CCAAGATCAAGGTGTCAGCAGGG - Intergenic
1084747481 11:71182434-71182456 CCAAGATCATGGTGTGGGCAGGG + Intronic
1084781476 11:71412485-71412507 CCAAAATCAAGGTGTCTGCAGGG - Intergenic
1086648147 11:89250588-89250610 CCAAGATCAAGGTGTCTGCAGGG + Intronic
1086965680 11:93025692-93025714 CCACGTCCCTGTTCTCTGCAAGG + Intergenic
1086999496 11:93400256-93400278 CCAAATTCAAGGTGTCAGCAGGG + Intronic
1087617591 11:100506200-100506222 CCAAGGTCAAGGTGTCAGCAGGG - Intergenic
1087730840 11:101777064-101777086 ACAAGATCATGTTCTTTGCAGGG + Intronic
1088365238 11:109033293-109033315 ACAAGATCATGTTCTTTGCATGG - Intergenic
1089860831 11:121588752-121588774 CCAAGATCAAGGTGTCGGCAGGG + Intronic
1090741367 11:129664272-129664294 CCAAGATCATGTACTTTGCAAGG + Intergenic
1091349824 11:134884181-134884203 GCAAGATCATGTTCTCTGCAGGG - Intergenic
1092038161 12:5359318-5359340 CCAAAATCAAGGTGTCTGCAGGG - Intergenic
1093543202 12:20312505-20312527 CCAAGATCATGGTGTGAGCATGG - Intergenic
1093974865 12:25410513-25410535 CCAAAATCAAGGTGTCTGCAGGG - Intronic
1094254291 12:28403602-28403624 CCAAGTTCATGGTATTAGGAGGG - Intronic
1094317163 12:29147318-29147340 CCAAGATCAAGATGTCTGCAGGG - Intergenic
1094453794 12:30610025-30610047 ACAAGTTCATGCTCTTTGCAGGG + Intergenic
1094722484 12:33078456-33078478 ACAAGATCATGTTTTCTGCAGGG - Intergenic
1095341798 12:41098366-41098388 ACAAGATCATGTTCTTTGCAGGG + Intergenic
1096665046 12:53158812-53158834 CCAAGGTCAAGGTCTGAGCAAGG - Intronic
1097482627 12:60149497-60149519 ATGAGTTCATGTTCTCTGCAGGG - Intergenic
1099901518 12:88716428-88716450 ACAAGGTCAAGGTCTTTGCAGGG + Intergenic
1099947218 12:89258429-89258451 CCAAGATCAAGGTGTCAGCAGGG - Intergenic
1099987631 12:89685944-89685966 CCAAGATCAAGGTGTCAGCAAGG - Intronic
1100218970 12:92483207-92483229 CCTAGATCAAGGTATCTGCAGGG - Intergenic
1100283551 12:93141373-93141395 CCAAATTTCTGGTTTCTGCATGG - Intergenic
1101343391 12:103863167-103863189 CCAAGGTCAAGGTGTCAGCAGGG - Intergenic
1101830304 12:108251686-108251708 CCAAGATCATGACTTCTGCAGGG - Intergenic
1102206083 12:111091704-111091726 CCAAGATCAAGGTGTCTGCAGGG + Intronic
1102403274 12:112649782-112649804 CCAAGATCAAGGTGTCAGCAGGG + Intronic
1102733192 12:115132800-115132822 GGAAGTTCAAGGTCTTTGCAAGG - Intergenic
1102821438 12:115912422-115912444 CCAAGATCAAGGTGTCTGCAGGG + Intergenic
1102988352 12:117296938-117296960 CCAAGATCATGGTGCCAGCATGG - Intronic
1103011690 12:117463001-117463023 CCAAGATCAAGGTGTCAGCAGGG - Exonic
1103173943 12:118845339-118845361 CCAAGATCAAGGTGTCAGCAGGG - Intergenic
1103250845 12:119498641-119498663 TCAAGTTCCTGCTCTCTGCTAGG + Intronic
1103863354 12:124031653-124031675 ACAAGTTCATGTCCTTTGCAGGG - Intronic
1104627384 12:130369208-130369230 ACAAGATCATGCTCTTTGCAGGG - Intronic
1106078528 13:26481733-26481755 CCAAGATCAAGGAGTCTGCAGGG + Intergenic
1106213407 13:27672223-27672245 CCAAGATCAAGGTGTCTGCAGGG - Intergenic
1106695401 13:32167297-32167319 CCAAGATCAAGGTGTCAGCAGGG + Intronic
1107013905 13:35694147-35694169 CCAAGGTGAAGGTGTCTGCAGGG - Intergenic
1107809438 13:44186140-44186162 CCAAGATCAAGGTGTCAGCAGGG + Intergenic
1108006101 13:45948246-45948268 CCGAGATCAAGGTCTCAGCAGGG + Intergenic
1109414365 13:62017701-62017723 CCAACTTCCTGCTCTCTGCAAGG + Intergenic
1109437669 13:62327582-62327604 GCAAGATCATGTCCTCTGCAAGG + Intergenic
1110355547 13:74562651-74562673 CCAAGATCAAGGTGTCAGCAAGG - Intergenic
1110687868 13:78396309-78396331 CCAAGTTCAGAGTCCCAGCATGG - Intergenic
1110807562 13:79774648-79774670 CCAAGATCACGGTGTCAGCAGGG + Intergenic
1111377828 13:87403627-87403649 GCAAATACATGGTCACTGCAAGG - Intergenic
1111709959 13:91798502-91798524 ACAAGATCATGTCCTCTGCAGGG - Intronic
1113077109 13:106477864-106477886 CCAAGATCAAGGTGTCAGCAGGG + Intergenic
1113323078 13:109256216-109256238 ACAAAATCATGTTCTCTGCAGGG + Intergenic
1113565249 13:111315835-111315857 CCAAGCTCAGGGTGTCAGCAGGG + Intergenic
1113899235 13:113787487-113787509 CAAAGTTCAGGGTCTTTGGAGGG + Intronic
1114062124 14:19027208-19027230 CCAAGTTCCTGGTCTCCGGGAGG + Intergenic
1114100132 14:19372789-19372811 CCAAGTTCCTGGTCTCCGGGAGG - Intergenic
1115499798 14:34039168-34039190 CTAATTTCATGGTCTCTGCAGGG - Intronic
1117410141 14:55442977-55442999 CCAAGATCAAGGTGTCAGCAGGG - Intronic
1117437666 14:55732449-55732471 CCAAGATCAAGGTTCCTGCAAGG + Intergenic
1117893152 14:60448866-60448888 ACGAGTTCATGTTCTTTGCAGGG + Intronic
1117953411 14:61104445-61104467 CCAAGATCAAGTTGTCTGCAGGG + Intergenic
1118085599 14:62412434-62412456 CCAGATACATGGTCTCTGAAAGG + Intergenic
1118139140 14:63060805-63060827 CCAAGATCAAGGTCTCAGCAGGG + Intronic
1118339871 14:64885583-64885605 CCAAGATCAAGGTTTCGGCAGGG + Intergenic
1119942811 14:78659241-78659263 CCAAGTTCAAGGTTTCAGCAAGG - Intronic
1120509415 14:85395568-85395590 ACAAGATCATGTCCTCTGCAGGG - Intergenic
1120876154 14:89378001-89378023 CCAAGATCAAGGTGTCAGCAGGG - Intronic
1121521309 14:94587841-94587863 CCAACTTTAGGGACTCTGCAGGG + Exonic
1121754808 14:96393451-96393473 CCAAGATCAAGGTGTCAGCAGGG + Intronic
1121794898 14:96726596-96726618 CCAAGATCAAGGTGTCAGCAGGG - Intergenic
1122181742 14:99960135-99960157 CCAAGATCAAGGTGTCAGCAGGG + Intergenic
1123494688 15:20814259-20814281 CCAAGTTCCTGGTCTCTGGGAGG - Intergenic
1123551183 15:21383352-21383374 CCAAGTTCCTGGTCTCTGGGAGG - Intergenic
1123976941 15:25562765-25562787 CCAAGATCAAGGTGTCAGCAGGG + Intergenic
1124360205 15:29031348-29031370 CCAAGATCAAGGTGTCAGCAGGG + Intronic
1124438005 15:29666842-29666864 CCAAAATCAAGGTGTCTGCAGGG + Intergenic
1125076031 15:35619547-35619569 ACAAGTTCATGTCCTTTGCAAGG - Intergenic
1125468872 15:39982855-39982877 ACAAGTTCATGTCCTTTGCAGGG - Intronic
1126675581 15:51157155-51157177 CCAAGATCAGGGTGTCAGCATGG - Intergenic
1126885576 15:53145702-53145724 CCAAGTTTATGGTGTCTTCTAGG + Intergenic
1127681660 15:61303777-61303799 CCAAGATCAAGGTGTCAGCAGGG + Intergenic
1127736573 15:61845851-61845873 CCTACTTCATGGTCTCTGAATGG - Intergenic
1128616190 15:69111861-69111883 CCAAGATCAAGGTATCAGCAGGG - Intergenic
1128685851 15:69685031-69685053 ACAAGTTCATGTCCTTTGCAGGG - Intergenic
1130873802 15:87994558-87994580 CCAAGATCAAGGTGTCTGGAGGG - Intronic
1131875982 15:96806973-96806995 CCAAGATCAAGATGTCTGCAAGG - Intergenic
1132138255 15:99366182-99366204 CCAAGATCAAGGTGTCAGCAGGG + Intronic
1202959525 15_KI270727v1_random:110595-110617 CCAAGTTCCTGGTCTCTGGGAGG - Intergenic
1133316734 16:4889591-4889613 CCAAGATCATTATCTCTGCTAGG + Intronic
1133835206 16:9361742-9361764 CCAAGATCAAGGTGTCGGCAGGG - Intergenic
1133835268 16:9362196-9362218 CCAAGATCAAGGTTTCGGCAGGG - Intergenic
1133873355 16:9710280-9710302 ACAAGATCATGTCCTCTGCAGGG - Intergenic
1133886135 16:9829528-9829550 GCAAGATCATGGTATCTGTATGG - Exonic
1133977191 16:10607656-10607678 CCAAGATCAAGGTGTCAGCAGGG - Intergenic
1135685922 16:24498363-24498385 CCAAGTTCAAGGTGCCAGCAGGG - Intergenic
1135860046 16:26048024-26048046 CCAAGATCAAGGTGTCGGCAGGG + Intronic
1136079518 16:27842568-27842590 CCAAGTTCAAGGTCTCAGGAAGG + Intronic
1136597322 16:31260290-31260312 CCACATTCATGGACTGTGCAAGG + Intronic
1137535617 16:49322238-49322260 CCAAGTTCATATTCTCTAAATGG + Intergenic
1137814970 16:51389881-51389903 CCAAGATCAAGCTGTCTGCAGGG + Intergenic
1138056662 16:53841540-53841562 CCAAGTTCATGGTCTCTGCAAGG - Intronic
1140631347 16:76856455-76856477 CCAAGATCAGGGTCCCAGCATGG + Intergenic
1141310199 16:82906701-82906723 CCATATTCATGGTTTCGGCAGGG + Intronic
1142659181 17:1415919-1415941 CCAAATTCATGATCCCTGCTGGG - Intergenic
1143567649 17:7734223-7734245 TCATGTTCATGGCCTCTGCAGGG - Exonic
1143771941 17:9174495-9174517 CCAAGATCAAGGTGTCAGCAGGG + Intronic
1144095148 17:11893545-11893567 ACAAGTTCATGTCCTTTGCAGGG + Intronic
1144397349 17:14857497-14857519 ACAAGTTCATGTCCTTTGCAGGG - Intergenic
1144433899 17:15222053-15222075 ACAAGTTCATGTCCTTTGCAGGG - Intergenic
1144468528 17:15516438-15516460 CCAAGATCAAGGTGTCAGCAGGG + Intronic
1144641234 17:16938122-16938144 CCAAGATCAAGGTGTCGGCAGGG - Intronic
1144873784 17:18386106-18386128 CCAAGATCAAGGTGTCGGCAGGG + Intronic
1145111426 17:20165368-20165390 ACAAGATCATGCCCTCTGCAGGG - Intronic
1145158683 17:20559684-20559706 CCAAGATCAAGGTGTCGGCAGGG - Intergenic
1145790005 17:27620641-27620663 CCATGCTCCTGGTCTCTGCTGGG - Intronic
1145912974 17:28552887-28552909 CCAGGCTCAGGGTCTCTGCTTGG + Intronic
1146840137 17:36146303-36146325 CCAAGATCAGGGTGTCAGCATGG + Intergenic
1146845804 17:36181546-36181568 CCAAGATCAAGGTGTCAGCAGGG + Intronic
1146947031 17:36880395-36880417 CCAAGTGCCTCCTCTCTGCAAGG - Intergenic
1147625373 17:41896619-41896641 CCAAGTCCAAGATCCCTGCAAGG - Exonic
1147948110 17:44091903-44091925 CCAAGGCCAAGGTCTCTGAATGG + Intronic
1148655852 17:49282840-49282862 ACAAGATCAAGGTGTCTGCAGGG - Intergenic
1148879285 17:50713370-50713392 CCAAGATCATGGTACCAGCATGG + Intergenic
1149107239 17:52984049-52984071 CTCAGTACATGGTCTCTGAATGG - Intergenic
1149544139 17:57490695-57490717 CCAAGATCATGGTCGCTTCTCGG - Intronic
1149789729 17:59466539-59466561 CCAAGGTCAAGGTGTCAGCAGGG - Intergenic
1149849007 17:60024487-60024509 CCAAGATCAAGGTGTCAGCAAGG + Intergenic
1149861161 17:60122037-60122059 CCAAGATCAAGGTGTCAGCAAGG - Intergenic
1150317164 17:64178638-64178660 CAAAGCTCATTGTTTCTGCAAGG - Intronic
1150454984 17:65300115-65300137 CCAAGATCAAGGTGTCAGCAGGG - Intergenic
1150604368 17:66678293-66678315 CCAAAATCAGGGGCTCTGCAGGG - Intronic
1150838755 17:68588543-68588565 CCAAGTTCGTGGTGTCAGCAGGG + Intronic
1151166346 17:72206891-72206913 CCAAGTGCATCGTCACTCCAAGG + Intergenic
1151872068 17:76843163-76843185 CCAAGTTCAAGGTGTTAGCAGGG - Intergenic
1151909044 17:77069395-77069417 CCAAGATCAAGGTGTCAGCAGGG + Intergenic
1153304417 18:3619109-3619131 CCAAGATCAAGGTATCAGCAAGG - Intronic
1153810396 18:8747268-8747290 CCAAGATCAGGGTGCCTGCAGGG + Intronic
1153810420 18:8747372-8747394 CCAAGATCAAGGTGCCTGCAGGG + Intronic
1153824776 18:8865334-8865356 CCAAGATCAAGGTGTCAGCAGGG + Intergenic
1154452089 18:14486776-14486798 CCAAGTTCCTGCTCTCTGGGAGG - Intergenic
1155398794 18:25416030-25416052 CCCAGTTCATGCTCTCTGTTGGG + Intergenic
1157549090 18:48568551-48568573 CCAAGATCAAGGTGTCAGCAGGG + Intronic
1157791104 18:50531961-50531983 CCAAGTGCCTTGTCTCTGTAGGG + Intergenic
1158201673 18:54948430-54948452 TCAAGATCAAGGTGTCTGCAGGG - Intronic
1158569827 18:58588746-58588768 ACAAGATCATGTCCTCTGCAGGG - Intronic
1158841667 18:61394575-61394597 CCAAGATCAAGGTGTTTGCAGGG - Intronic
1159008944 18:63040283-63040305 CCAAGATCAGGGTGTCGGCAGGG + Intergenic
1159305732 18:66640025-66640047 ACAAGTTCATGTCCTTTGCAGGG + Intergenic
1159913424 18:74167328-74167350 CCAAGATCAAGGTGTCAGCAGGG - Intergenic
1160228959 18:77032141-77032163 CAAATTCCATGGTCTCTGCAGGG - Intronic
1162147539 19:8621913-8621935 CCAAGTTCAAGGTGTCAGTAGGG - Intergenic
1162157756 19:8691089-8691111 CCAAGTTCAAGGTGTCAGCAGGG + Intergenic
1162311887 19:9913012-9913034 CCACCTTCAAGGTCTCTGCCTGG - Intronic
1163172385 19:15541262-15541284 CCAAGATCAAGGTATCTGCAGGG + Intronic
1163437615 19:17304704-17304726 CCAAGTTCAAGGGCTCCTCAAGG - Intronic
1163795766 19:19337295-19337317 CCAGGGTCATGGTCCCTGCCGGG - Intronic
1164657514 19:29934412-29934434 CCAAGATCAAGGTGTCAGCAGGG + Intronic
1166702850 19:44891979-44892001 CCAAGGTCACGGTGTCAGCAAGG + Intronic
1166883357 19:45942410-45942432 CCAAGATCAAGGTGTCAGCAGGG - Intronic
1166996896 19:46723697-46723719 CCAAGTGCATGGGCTTTGCCTGG + Intronic
1167202288 19:48074295-48074317 ACAAGATCATGTCCTCTGCAGGG - Intronic
1167498549 19:49832791-49832813 CCAAGGTCAGGGTGTCAGCAGGG + Intronic
925152629 2:1625612-1625634 CCACATTCCTGGCCTCTGCAAGG + Intergenic
925263076 2:2545046-2545068 CCAAGTTCAAGGTCTCAGCAGGG + Intergenic
925331956 2:3065293-3065315 ACAAGATCATGTTCTTTGCAGGG + Intergenic
925703081 2:6658604-6658626 CCAAGATCAAGGTGTCAGCAGGG - Intergenic
925811979 2:7710013-7710035 CAAAGTTCATGGTATCCCCATGG + Intergenic
925914252 2:8593426-8593448 CCAAGATTAAGGTGTCTGCAGGG - Intergenic
926028265 2:9563627-9563649 CCAAAATCAGGGTGTCTGCAGGG - Intergenic
926270871 2:11365109-11365131 CCAAGTTCATGTTCTTTGGGAGG - Intergenic
926351075 2:11994962-11994984 CCAAGATCAAGGTGTCAGCAGGG - Intergenic
926458207 2:13095560-13095582 CCATGTTCAAGGTCACTTCAAGG + Intergenic
927091703 2:19717401-19717423 CCAAGGTCAAGGTATCAGCATGG - Intergenic
928220253 2:29397410-29397432 CCAAGATCAAGGTGTCAGCAGGG - Intronic
929032203 2:37659665-37659687 GCAAGTTCATTGTTTCTCCAGGG - Intronic
931233770 2:60396171-60396193 CCAAAATCAGGGTATCTGCAAGG + Intergenic
931258620 2:60597396-60597418 CCAAGATCAAGGTATCAGCAGGG - Intergenic
932141668 2:69283946-69283968 CCAAGATCAAGGTGTCAGCAGGG - Intergenic
933001940 2:76936268-76936290 ACAAGTTCATGGCCTTTTCAGGG + Intronic
933048003 2:77563477-77563499 CCAAGATCATGTCCTTTGCAGGG + Intronic
933195597 2:79385844-79385866 ACATGTTCATGGCCTTTGCAGGG - Intronic
933282036 2:80342870-80342892 CCAAGATCAAGGTATCAGCATGG + Intronic
934690739 2:96356857-96356879 TCACGTTATTGGTCTCTGCATGG + Intronic
935070762 2:99691789-99691811 CTATGATCATGGGCTCTGCAGGG - Intronic
935160174 2:100523267-100523289 CCAAGATCAAGGTGTCAGCAGGG + Intergenic
935322470 2:101902356-101902378 CCAAGATCAAGGTGCCTGCAGGG - Intergenic
935423688 2:102897320-102897342 CCAAGATCATGGTGTCAGCAGGG + Intergenic
935655582 2:105420160-105420182 CCAAGATCAAGGTGTCAGCAGGG + Intronic
935700701 2:105809386-105809408 CCAAGATCAAGGGCTCAGCAGGG + Intronic
936925913 2:117736757-117736779 CCAAGATCAAGGTGTCAGCAGGG - Intergenic
937165982 2:119817862-119817884 GCAAGTTAAAGATCTCTGCAAGG - Intronic
937219021 2:120330872-120330894 CCAAGATCAAGGTGTCGGCACGG - Intergenic
937231905 2:120402978-120403000 ACAAGATCATGTTCTTTGCAAGG - Intergenic
937232979 2:120411016-120411038 ACAAGATCATGTTCTTTGCAAGG - Intergenic
937441692 2:121920874-121920896 CCAAGATCAAGGTGCCTGCAGGG + Intergenic
938304431 2:130242164-130242186 CCAAGATCAAGGTGTCAGCAGGG + Intergenic
938479492 2:131647389-131647411 CCAAGTTCCTGGTCTCCGGGAGG + Intergenic
939406491 2:141764618-141764640 CCAAGATCAGGGTGTCAGCAGGG - Intronic
940048436 2:149435182-149435204 CCAAGATCAAGGTGTCGGCAAGG - Intronic
940395285 2:153182773-153182795 ACAAGATCATGTTCTTTGCAGGG - Intergenic
940800606 2:158128712-158128734 ACATGTTCATAGTCTCTGGACGG + Intronic
943287006 2:186014568-186014590 ACAAGATCATGTTCTTTGCAGGG + Intergenic
945124215 2:206490227-206490249 CCAAGATCAAGGTGTCAGCAGGG - Intronic
945480061 2:210335132-210335154 ACAAGTTCATGTCCTTTGCAGGG + Intergenic
945702780 2:213191769-213191791 CCAAGGTCAAGGTGTCAGCAGGG + Intergenic
945942395 2:215962465-215962487 CCGAGTTCTGGGGCTCTGCAAGG + Intronic
946201748 2:218074532-218074554 AAAAGTTCAGGGTCTCTTCATGG + Intronic
946448993 2:219763730-219763752 CCAAGATCAAGGTGTCAGCAGGG + Intergenic
946699333 2:222395844-222395866 CCAAGATCAAGGTGTCAGCAGGG + Intergenic
947309413 2:228784127-228784149 CTAAGTTCATGTCCTTTGCAGGG - Intergenic
947492702 2:230609803-230609825 ATAAGTTCATGTTCTTTGCAGGG + Intergenic
947521073 2:230846542-230846564 CCAAGACCAAGGTGTCTGCAGGG + Intergenic
947541607 2:230983740-230983762 CCAAGATCAAGGTGTCAGCAGGG + Intergenic
948551063 2:238773235-238773257 CCAAGATCAAGCTATCTGCAGGG + Intergenic
1168930436 20:1619141-1619163 CCAAGATCAAGGTGTCAGCAGGG - Intronic
1169239781 20:3966763-3966785 CCAATTTCAAGAACTCTGCAGGG - Intronic
1169667064 20:8049495-8049517 CCAAGTTCATGCTCCCTTCTGGG - Intergenic
1170022380 20:11850581-11850603 CCAAGATCAAGGTGTCAGCATGG - Intergenic
1170059073 20:12240587-12240609 CTAAGTTCATGCCCTTTGCAGGG + Intergenic
1172880260 20:38195209-38195231 CCAAGTTCATGGCATGTCCACGG + Intergenic
1173024794 20:39298085-39298107 GAAAATTCATTGTCTCTGCATGG - Intergenic
1173388909 20:42614048-42614070 CCAAGATCAAGGTGTCAGCAGGG + Intronic
1173859453 20:46273138-46273160 CCAAGTTCATGGCCTGAACAAGG - Intronic
1175740066 20:61413932-61413954 CCAAGTCCACGGTGTCTGCAGGG + Intronic
1176157567 20:63629564-63629586 CCAAAATCAGGGTGTCTGCAGGG + Intergenic
1176430587 21:6573288-6573310 CCAGGTACTTGGTTTCTGCAGGG + Intergenic
1176443935 21:6801524-6801546 CCAAGTTCCTGGTCTCCGGGAGG + Intergenic
1176822104 21:13666563-13666585 CCAAGTTCCTGGTCTCCGGGAGG + Intergenic
1177421295 21:20861238-20861260 CCAAGATCAAGGTGCCTGCAGGG - Intergenic
1178346193 21:31830316-31830338 CCAAGATCAAGGTGTCAGCAAGG - Intergenic
1178472589 21:32906685-32906707 CCAAGATCAAGGTGTCAGCAAGG + Intergenic
1178686511 21:34715500-34715522 CCAAGATCAGGGTATCAGCAGGG - Intronic
1179020665 21:37637910-37637932 CCAAGATCAAGGTGTCAGCAGGG - Intronic
1179038317 21:37779433-37779455 ACAAGTTCATGGTCCCCCCAAGG - Intronic
1179119272 21:38527988-38528010 CCAAGATCAAGGTGTCAGCAGGG + Intronic
1179153960 21:38833450-38833472 CCAAGATCATGGTGTCTATAAGG + Intergenic
1179302471 21:40124742-40124764 CCAAAATCAAGGTGTCTGCAGGG - Intronic
1179705981 21:43180750-43180772 CCAGGTACTTGGTTTCTGCAGGG + Intergenic
1179808346 21:43854334-43854356 CCAAGATCAAGGTGTCAGCAGGG - Intergenic
1180480614 22:15749822-15749844 CCAAGTTCCTGGTCTCCGGGAGG + Intergenic
1180878012 22:19184238-19184260 TCAGGTTCCTGGTCTCTGAATGG - Intronic
1181388633 22:22562951-22562973 CCAAGATCAAGGTGTCAGCAAGG + Exonic
1182465491 22:30513652-30513674 CCAAGATCAAGGTGTCAGCAGGG - Intergenic
1182986980 22:34729021-34729043 CCCAGTTCATGTCCTTTGCAGGG + Intergenic
1183252398 22:36739374-36739396 CCAAGATCAAGGTGTCAGCAGGG - Intergenic
1183338296 22:37263671-37263693 CCAAGATCAAGGTGTCAGCAGGG - Intergenic
1184138323 22:42562384-42562406 CCAAGGTCAAGGCCTCGGCAGGG + Intronic
1184367020 22:44058202-44058224 CCAAGATCAAGGTGTCAGCAGGG + Intronic
1184398299 22:44258630-44258652 ACAAGATCATGTTCTTTGCAGGG - Intronic
1184544453 22:45157107-45157129 CCAAGATCAAGGTGTCAGCAGGG - Intergenic
1184976981 22:48069264-48069286 CCAAGATCATGGTGTTGGCAGGG + Intergenic
949440737 3:4077486-4077508 ACAAGTTCATGTCCTTTGCAGGG + Intronic
949959196 3:9298024-9298046 CCAAGATCAAGGTGTCAGCAGGG - Intronic
950394495 3:12723459-12723481 CCAAGATCAAGGTGTCAGCATGG - Intergenic
950535010 3:13573520-13573542 CCAAGGTCAGGGTCTCTGCTGGG + Intronic
950912720 3:16611636-16611658 CCAAGATCAGGGTGTCAGCATGG - Intronic
951253953 3:20427452-20427474 ACAAGTTCATGTTATTTGCAGGG - Intergenic
951355082 3:21656346-21656368 CCAAGATCAAGGTGTCAGCAGGG + Intronic
951398102 3:22195852-22195874 ACAAGATCATGTTCTTTGCAGGG + Intronic
951936829 3:28031525-28031547 CCAAGATCAAGGTGTCAGCAGGG - Intergenic
952029679 3:29126107-29126129 ATGAGTTCATGTTCTCTGCAGGG - Intergenic
953034680 3:39201502-39201524 CCAAGATCAAGGTGTCAGCAGGG - Intergenic
953213465 3:40896928-40896950 CCAAATACATGGTCACTGAAGGG + Intergenic
953261973 3:41348401-41348423 CCAAGTGCAGGGTTTGTGCAAGG + Intronic
953547432 3:43873910-43873932 CCAAGCTCAAGGTGTCAGCAGGG - Intergenic
954340038 3:49946066-49946088 CCAAGATCAAGGTGTCAGCAAGG - Intronic
954973485 3:54671616-54671638 TGAGGTTCGTGGTCTCTGCACGG + Intronic
955565686 3:60242560-60242582 TCAAGTACCTGCTCTCTGCAAGG - Intronic
957562575 3:81842130-81842152 TCAATATCATGGTCTCAGCATGG + Intergenic
957906420 3:86561930-86561952 CCGAGTTCATGTCCTTTGCAGGG - Intergenic
958157027 3:89768430-89768452 CCAAGATCATGTCCTTTGCAGGG - Intergenic
958756242 3:98252723-98252745 ACAAGTTCATGTCCTTTGCAGGG + Intergenic
960124822 3:113986915-113986937 CCAAGATCAGGGTGCCTGCATGG - Intronic
960321755 3:116245260-116245282 CCAAGTTCAAGGTGTCAGCAGGG - Intronic
960511126 3:118550705-118550727 CCAAGTTTATTGTCTGAGCAGGG - Intergenic
960772395 3:121209079-121209101 ACAAGTTCATGTCCTTTGCAGGG - Intronic
961269878 3:125680660-125680682 CCTAGTTCATGGTGTCAGCCTGG - Intergenic
961305522 3:125957181-125957203 ACAAGTTCATGTCCTTTGCAGGG - Intergenic
961641416 3:128366972-128366994 CCAAGATCAAGGTGTCTGCAGGG + Intronic
962168066 3:133071261-133071283 CCAAGATCAGGGTGTCAGCAGGG + Intronic
962392876 3:134987863-134987885 CCAAGATCAAGGTATCAGCAGGG - Intronic
962533335 3:136304013-136304035 CCAAGATCATGGTGTTGGCAGGG + Intronic
962602292 3:137002085-137002107 ACAAGTTCATGTCCTTTGCAGGG - Intronic
963045566 3:141100536-141100558 CCAAGATCAAGGTGTCTACAGGG - Intronic
964292806 3:155200054-155200076 CCAAGTTCAAGGTGTCAGCAAGG - Intergenic
964874648 3:161352855-161352877 AAAAGTTCATGGACTCTGCAGGG + Intronic
966628225 3:182042853-182042875 ATAAGTTCATGTTCTTTGCAGGG - Intergenic
966753719 3:183348232-183348254 ACGAGTTCATGTTCTTTGCAGGG + Intronic
967699660 3:192576886-192576908 ACGAGTTCATGTTCTTTGCAGGG + Intronic
969045019 4:4330391-4330413 CCAGGATCAAGGTGTCTGCAGGG - Intergenic
969515635 4:7646727-7646749 CCAAGATCAAGGTATCGGCAGGG - Intronic
969575849 4:8035264-8035286 CCAAGCTCAAGGGCTGTGCAGGG - Intronic
969843707 4:9902569-9902591 CCAAGATCAAAGTGTCTGCAGGG + Intronic
969916423 4:10495980-10496002 CCAATATCATGGTATCAGCAGGG - Intronic
970920015 4:21383177-21383199 CCAAGATCAAGGTGTCAGCAGGG - Intronic
971420429 4:26469190-26469212 CCAAGATCAAGGTGTCAGCAGGG + Intergenic
971550354 4:27947515-27947537 TCAAGTTCATTATCTCAGCAGGG - Intergenic
972297745 4:37756400-37756422 GCCAGTTCATGGTCTCGCCAGGG + Intergenic
974233282 4:59145903-59145925 ACAAGATCATGTTCTTTGCAAGG - Intergenic
974570067 4:63634151-63634173 CTAAGTTCATGGTTTCAGAAAGG - Intergenic
976136875 4:81947217-81947239 CCAGGTTCAGAGACTCTGCAGGG - Intronic
976511914 4:85921211-85921233 ACAAGATCATGTTCTTTGCAGGG + Intronic
976860174 4:89655715-89655737 CCAAGATCAAGGTGCCTGCAGGG + Intergenic
976914047 4:90347945-90347967 ACAAGATCATGTTCTTTGCAGGG + Intronic
977698726 4:99996574-99996596 CCAAGCTCAAGGTCTCAGTAGGG + Intergenic
977772603 4:100877660-100877682 CCAAGAACATGGGCTCTGTAAGG + Intronic
977814767 4:101402208-101402230 ACAAGATCATGTTCTTTGCAGGG + Intergenic
977912067 4:102548637-102548659 CCAATATCATGGTCTTCGCAGGG + Intronic
980568011 4:134571167-134571189 ACAAGTTCATGTCCTTTGCAGGG - Intergenic
980681562 4:136168967-136168989 CAAAGTTCATGGTCCCTTCTTGG + Intergenic
980851631 4:138389200-138389222 ACAAGTTCATGTCCTTTGCAAGG - Intergenic
981009050 4:139905657-139905679 CCAAGATCAAGGTATCTGCAGGG + Intronic
982028319 4:151274827-151274849 CCAAGATCAAGGTATCAGCATGG + Intronic
982434437 4:155367437-155367459 CCAAGATCAAGGTGTTTGCAGGG - Intronic
982610559 4:157569041-157569063 CCAAGATCAAGGTGTCAGCAGGG + Intergenic
983927565 4:173418204-173418226 CCAAGTCCAAGGTCAATGCAGGG - Intergenic
984717317 4:182937940-182937962 CCAAGATCAAGGTGTCGGCAGGG + Intergenic
984722407 4:182987419-182987441 CCAAGATCAAGGTGTCAGCAGGG - Intergenic
984731925 4:183076321-183076343 CCAAGATCAAGGTGTCAGCAGGG + Intergenic
984882896 4:184425944-184425966 CCAAAATCAAGGTCTCTGCAGGG + Intronic
985547046 5:515029-515051 CCAAGCTCCTGGTCCCTGGAGGG - Intronic
985713007 5:1440805-1440827 CCAAGATCAAGGTGTCTGTAGGG - Intronic
985760074 5:1744261-1744283 CCAAGATCAAGGTGTCAGCATGG - Intergenic
985808820 5:2068419-2068441 CTGAATTCAGGGTCTCTGCAGGG - Intergenic
986001615 5:3634979-3635001 CCAAGATCAAGGTGTCGGCAGGG - Intergenic
986068689 5:4261056-4261078 CCAAGATCAAGGTGTCAGCAGGG - Intergenic
986297814 5:6454253-6454275 CCAAGATCAAGGTGTCAGCAGGG + Intronic
986366264 5:7035250-7035272 ATAAGTTCATGTTCTTTGCAGGG - Intergenic
986789099 5:11143356-11143378 TCAAGATCAAGGTGTCTGCAGGG + Intronic
986976285 5:13398105-13398127 CCAAGATCAAGGTGTCAGCAGGG - Intergenic
987038248 5:14038816-14038838 CCAAGATCAAGGTGTCAGCAGGG + Intergenic
987095628 5:14546692-14546714 CCAAGATCAAGGCATCTGCAGGG - Intergenic
987237118 5:15953933-15953955 CCAAGATCAAGGTGTCTTCAGGG - Intergenic
987341999 5:16947532-16947554 CCAAGATCAAGGTCTCAGCAGGG - Intergenic
987778297 5:22397949-22397971 CCAAGATCAAGGTGTCAGCAGGG - Intronic
988200414 5:28062341-28062363 CCAAGATCAAAGTCTCAGCAGGG + Intergenic
988413421 5:30915563-30915585 CCAAGATCATGGTGCCTGCAAGG + Intergenic
989138735 5:38181474-38181496 CCAAGATCAAGGTGCCTGCAGGG - Intergenic
989164600 5:38422106-38422128 CCTTGTTCATGGTCTCTTTAAGG + Intronic
990512808 5:56504128-56504150 CCAAGATCAAGGTGTCGGCAGGG + Intergenic
991261424 5:64672285-64672307 CCAAATTCAAGGTGTCAGCAGGG - Intergenic
991939975 5:71841302-71841324 CCAAGATCAAGGTGTCAGCAGGG - Intergenic
992366493 5:76096558-76096580 CCCAGTTCATGTTTTCTGCGTGG + Intronic
992534575 5:77686127-77686149 CCAAAATCAAGGTGTCTGCAAGG + Intergenic
992757249 5:79919561-79919583 ACAAGATCATGGCCTTTGCAGGG + Intergenic
992982893 5:82195110-82195132 CCAAGTTCATGGGACCAGCAGGG - Intronic
994262287 5:97673967-97673989 ACAAGATCATGTTCTTTGCAGGG - Intergenic
995380100 5:111522521-111522543 CTAAGATCAAGGTGTCTGCAAGG + Intergenic
996004238 5:118401963-118401985 AGAAGTTCATGTTCTTTGCAGGG - Intergenic
996436565 5:123439571-123439593 CCAAGATCAAGGTGTCAGCAAGG - Intergenic
997607124 5:135183030-135183052 CCAAGTTCTTAGCCTCTCCATGG - Intronic
997669253 5:135656879-135656901 TCAAGATCAAGGTGTCTGCAGGG - Intergenic
998491937 5:142554676-142554698 CCAAGATCAAGGTGTCAGCAGGG + Intergenic
998506990 5:142679943-142679965 CCAAGATCAAGGTGTCAGCAGGG + Intronic
998923892 5:147101209-147101231 CCAAGTTCAAGGTGCCAGCATGG + Intergenic
999081576 5:148849172-148849194 CCAAGATCAAGGTGCCTGCAGGG + Intergenic
1000006375 5:157188464-157188486 CCAAGCTCAAGGTCTCAGCAGGG + Intronic
1000436460 5:161216511-161216533 CCAACTTCATAGTCTTTGCAAGG - Intergenic
1000662812 5:163956763-163956785 CCAAGATCAAGGTGTCAGCAGGG - Intergenic
1000929571 5:167235081-167235103 CCAAGATTATGGTGTCAGCAGGG + Intergenic
1000939255 5:167340413-167340435 CCAAGATCAGGGTCCCAGCATGG + Intronic
1001082348 5:168676580-168676602 ACAAGTTTATGGTCTCTGCACGG - Intronic
1001765277 5:174240995-174241017 CCAAGGTCAAGGTGTCAGCAGGG + Intronic
1001904754 5:175462415-175462437 CCAAGTTCAGAGTGTCGGCAGGG - Intergenic
1001943020 5:175754044-175754066 CGAGGTTCATCCTCTCTGCAGGG - Intergenic
1003128071 6:3372107-3372129 CCAGGTTCATGGCCTCAGCACGG - Intronic
1003130828 6:3394043-3394065 CTTATTTCATGTTCTCTGCAGGG - Intronic
1003260180 6:4509843-4509865 CCCAGACCATGGTCTCAGCAAGG - Intergenic
1003751918 6:9068578-9068600 CCAAGATCAAGGTGTCAGCAGGG + Intergenic
1003819112 6:9876187-9876209 CCAAGATCAGGGTACCTGCATGG - Intronic
1004084957 6:12437933-12437955 CCAAGATCAGGGTGTCTGCAGGG + Intergenic
1004233798 6:13855413-13855435 CCAAGATCATAGTGTCAGCAGGG + Intergenic
1004540764 6:16547592-16547614 CCGAGATCAAGGTGTCTGCAGGG + Intronic
1006571657 6:35010409-35010431 CCAAGTTCAAGGCATCAGCATGG + Intronic
1008393249 6:50977690-50977712 CCCAGATCAAGGTGTCTGCAGGG + Intergenic
1009958975 6:70495948-70495970 ACAAGTTCATGTCCTTTGCAGGG - Intronic
1010149260 6:72711281-72711303 CCAAGATCATGGTGTTGGCAGGG - Intronic
1010185196 6:73135791-73135813 CCAAGTTTAAGGTGTCAGCAGGG + Intronic
1010467111 6:76180907-76180929 ACAAGATCATGGCCTTTGCAAGG - Intergenic
1010468917 6:76202159-76202181 ACGAGTTCATGTTCTTTGCAGGG + Intergenic
1010602127 6:77842122-77842144 CCAAATTCATAGTCTTTTCAAGG + Intronic
1010886135 6:81243576-81243598 ATGAGTTCATGGTCTTTGCAGGG + Intergenic
1011670596 6:89679683-89679705 CCAAGATCAAGGTGTCAGCAAGG - Intronic
1011684100 6:89810511-89810533 CCAAGATCAGGGTGTCAGCAAGG + Intronic
1013302107 6:108813405-108813427 ATAAGTTCATGTTCTTTGCAGGG - Intergenic
1013584952 6:111570186-111570208 CCAAGATCAAGGTTTCAGCAGGG - Intronic
1013607695 6:111765465-111765487 CCAAGTTCATGGTGCAGGCAGGG - Intronic
1014754971 6:125292540-125292562 CCAAGTCCATGTTCTTTTCAAGG + Intronic
1015542249 6:134326746-134326768 CCAATTTCAAGGTGTCAGCATGG + Intergenic
1015963488 6:138674630-138674652 ACAAGATCATGTTCTTTGCAGGG - Intronic
1016290834 6:142526684-142526706 CCAACTTCATGCTCTCTTCCAGG - Intergenic
1016372728 6:143391674-143391696 CCAAGATCAAGGTGTCAGCAGGG + Intergenic
1016417858 6:143851884-143851906 ACACGTTCATGTCCTCTGCAGGG - Intronic
1016770551 6:147845362-147845384 CCAAGATCATAGTCTATACAAGG + Intergenic
1016929767 6:149392552-149392574 CCAAAGTCAAGGTTTCTGCAGGG + Intronic
1017942091 6:159061870-159061892 CCAAGATCAAGGTGTCAGCAGGG - Intergenic
1018173247 6:161158626-161158648 CAACGTCCAGGGTCTCTGCAAGG - Intronic
1018446427 6:163863062-163863084 CCAAGATCAAGGTGTCTGCAGGG - Intergenic
1018456727 6:163960258-163960280 CCAGATTCTTTGTCTCTGCAAGG + Intergenic
1018674749 6:166209436-166209458 CCATGTTAATTTTCTCTGCATGG - Intergenic
1019432813 7:1007303-1007325 CCCAGTCCAGGGCCTCTGCAGGG + Intronic
1019736583 7:2652878-2652900 CCAAGTCCATGGGCGCTGCTGGG - Intronic
1019799812 7:3080010-3080032 GCAAGATCAAGGTGTCTGCAGGG - Intergenic
1021537416 7:21721514-21721536 CCAAGATTATGGTGTCAGCATGG + Intronic
1021773053 7:24024444-24024466 CTAAGTTGATGGGCTCTTCAGGG - Intergenic
1022047265 7:26631817-26631839 CCAATTTCATGGTCTTTGGGAGG + Intergenic
1022075782 7:26968498-26968520 ACAAGATCATGTCCTCTGCAGGG - Intronic
1022818798 7:33938578-33938600 CCAAGATCAAGGTGTCGGCAGGG - Intronic
1022883177 7:34612181-34612203 CCAAGATCATGAGCTCTGCCTGG - Intergenic
1023402199 7:39798389-39798411 CCAAGTACATGGTCTGGGCAGGG + Intergenic
1024123800 7:46271207-46271229 CCAAGATCAAGGTGTCAGCAGGG - Intergenic
1024288678 7:47783744-47783766 CCAAGGTCAGGGTGTCAGCAGGG - Intronic
1024436875 7:49366824-49366846 CCAAGATCAAGGTGTCGGCAGGG + Intergenic
1024441363 7:49422101-49422123 CCAAGATCAAGGTGCCTGCAGGG - Intergenic
1024472702 7:49779771-49779793 CCAAGATCAAGGTGTCAGCAGGG + Intronic
1024647421 7:51382271-51382293 CCAAGTACATGGTCTGGGCAGGG - Intergenic
1025051255 7:55736766-55736788 CCAAGTACATGGTCTGGGCAGGG - Intergenic
1025060021 7:55798021-55798043 CCGAGTACATGGTCTGGGCAGGG - Intronic
1025128217 7:56362442-56362464 CCAAGTACTTGGTCTGGGCAGGG - Intergenic
1026703048 7:72664449-72664471 ACAAGATCATGTCCTCTGCAGGG + Intronic
1026974935 7:74491639-74491661 ACAAGATCATGTTCTTTGCAGGG - Intronic
1027369102 7:77489263-77489285 AGAAGTTCATGCTCACTGCAGGG + Intergenic
1027589218 7:80096754-80096776 CCAAGTTCAAGTTCCCTGGATGG - Intergenic
1027835540 7:83236636-83236658 CCAAGATCATGGTGTCAGCATGG - Intergenic
1027901145 7:84116782-84116804 CCAAGTTCAAGGTGTAAGCAGGG - Intronic
1028147744 7:87337045-87337067 CCAAGATCATGTCCTTTGCAGGG - Intergenic
1028787784 7:94816127-94816149 CTGAGTTCATGTTCTTTGCAGGG - Intergenic
1029148927 7:98466535-98466557 CCAAGATCAAGGTGTCAGCAGGG + Intergenic
1030783878 7:113636306-113636328 GCTAGTTCAGGGTCTCTGGAAGG - Intergenic
1032052713 7:128658782-128658804 CCAAGTACATGGTCTGGGCAGGG + Intergenic
1032746531 7:134792138-134792160 CCAAGATCAAGGTGTCAGCAGGG + Intronic
1033868057 7:145716505-145716527 ACAAGATCATGCTCTTTGCAGGG - Intergenic
1034393691 7:150804236-150804258 CCAAGTTCGTGGCTTCTGGAGGG - Intronic
1034732596 7:153400857-153400879 CCTAGTTCACTGTCTCTGCATGG + Intergenic
1034848100 7:154466409-154466431 CCAAGATCAAGGTGTCAGCAGGG + Intronic
1034975015 7:155443194-155443216 CCAAGATCAAGGGCTCAGCAGGG - Intergenic
1035124026 7:156594886-156594908 CCAAGATCAAGGTGTCAGCAGGG - Intergenic
1035576768 8:713024-713046 CCAAGGTCATAGTCTCAGCAGGG + Intronic
1036447117 8:8831039-8831061 CCAAGATCAGGGTGCCTGCATGG + Intronic
1036607536 8:10320708-10320730 CCAAGATCAAGGTGTCGGCAGGG + Intronic
1036973269 8:13379825-13379847 TTGAGTTCATGGTCTTTGCAGGG + Intronic
1037209761 8:16372312-16372334 CCAAAATCAAGGTATCTGCAGGG + Intronic
1037610352 8:20470863-20470885 CCAAGGTCAAGGTATCAGCAGGG + Intergenic
1037692928 8:21197948-21197970 CCAAATTCAAGGTGTCAGCAAGG - Intergenic
1038276670 8:26127132-26127154 CCAAGATCAAGGTGCCTGCAGGG + Intergenic
1038500553 8:28040077-28040099 CCAAGATCAAGGTGTCAGCAGGG - Intronic
1038750929 8:30295054-30295076 ACAAGTTCATGTCCTTTGCAGGG - Intergenic
1039024895 8:33247368-33247390 ACAAGATCATGTTCTTTGCAGGG - Intergenic
1039046824 8:33458218-33458240 CCAAGATCAAGGTGTCAGCAGGG - Intronic
1039549852 8:38435517-38435539 CCAAGTTCAGGGCCACTGGATGG - Intronic
1039643128 8:39245645-39245667 CCAAGATCAAGGTGTCTGCAGGG - Intronic
1041080206 8:54208460-54208482 CCAAGGTCAAGGTGCCTGCAGGG + Intergenic
1042422407 8:68607340-68607362 CCAAGATCAAGGTGTCGGCAGGG + Intronic
1042701865 8:71624382-71624404 TCAAGCTCATGGTCTTTGGATGG + Intergenic
1042816498 8:72883100-72883122 CCAGGTTCCCAGTCTCTGCAAGG + Intronic
1042997644 8:74718688-74718710 CCAAGATCAGGGTGTCAGCAAGG + Intronic
1043074918 8:75686029-75686051 TCAAGTTCATGTTCCCTTCATGG + Intergenic
1043171102 8:76967685-76967707 CCATGGACTTGGTCTCTGCAGGG - Intergenic
1043625694 8:82255346-82255368 ACAAGATCATGTTCTTTGCAGGG - Intergenic
1043846232 8:85167244-85167266 ACAAGATCATGTTCTTTGCAGGG + Intergenic
1044650374 8:94487403-94487425 CCAAGATCAGGGTGTCAGCATGG - Intergenic
1044667647 8:94647471-94647493 CCAAGATCAGGGTGTCAGCATGG + Intronic
1045508139 8:102793196-102793218 CCAAGGTCAAGGTGTCAGCAGGG - Intergenic
1045595166 8:103646710-103646732 CCAAGATCATGTCCTTTGCAGGG - Intronic
1045618229 8:103942306-103942328 ACAAGATCATGTTCTTTGCAGGG - Intronic
1045801853 8:106111048-106111070 CCAAGGTTATGATTTCTGCAAGG + Intergenic
1046001363 8:108424467-108424489 CCAAGATCAAGGTGTCTGCAGGG + Intronic
1046024579 8:108707015-108707037 CCAAGTTCATGTCCTTTGCAGGG + Intronic
1046601252 8:116319604-116319626 ACAAGATCATGCCCTCTGCAGGG + Intergenic
1048320858 8:133399301-133399323 ACAAGTTCATGTCCTTTGCAGGG - Intergenic
1048473431 8:134723027-134723049 CCAAGATCAAGGTGTCAGCAGGG - Intergenic
1048816075 8:138334704-138334726 ACAAGATCATGTTCTTTGCAGGG - Intronic
1049345602 8:142136913-142136935 TCAAGATCAAGGTGTCTGCAGGG + Intergenic
1049699208 8:144000434-144000456 CTAAGATCAAGGTGTCTGCAGGG - Intronic
1051021047 9:12543037-12543059 CTGAGTTCATGTCCTCTGCAGGG - Intergenic
1051334767 9:16055744-16055766 CCAAGTTCAGGGGCTCAGGAAGG + Intronic
1051466929 9:17390061-17390083 CCAAGATCAAGGTGTCAGCAGGG - Intronic
1051574191 9:18595910-18595932 CCTAGGTCATGGGCTCTGCTAGG + Intronic
1054882586 9:70160510-70160532 CAAAGTTCATGTTCTTTTCATGG - Intronic
1055078462 9:72242222-72242244 CCAAATGCATGGTCTTGGCAGGG - Intronic
1055674941 9:78648573-78648595 ACAAGTTCATGTCCTTTGCAGGG + Intergenic
1056447088 9:86676671-86676693 GCAGGTTAATGGTGTCTGCATGG - Intergenic
1057348454 9:94274017-94274039 CCAAGATCAAGGTTTCGGCAGGG + Intronic
1057460843 9:95260370-95260392 CTAAGTTCATGTCCTTTGCAGGG + Intronic
1058177786 9:101757867-101757889 CCCATTTCATGCTCTCTTCAGGG - Intergenic
1058198665 9:102010533-102010555 CCAACTGTATGCTCTCTGCAAGG + Intergenic
1058355788 9:104082303-104082325 CAAAGTTCCTGTTCTCTGAATGG + Intergenic
1058377453 9:104339719-104339741 CCAAGATCAGGGTTTCAGCAGGG - Intergenic
1058500615 9:105611657-105611679 ACAAGATCATGTTCTTTGCAGGG - Intronic
1059062821 9:111051461-111051483 CCAAGTTCCTGGTGTTGGCAGGG + Intergenic
1059666680 9:116453001-116453023 CCAAGTTGGTGGCCTCTGCTTGG - Intronic
1060376332 9:123117792-123117814 CCGAGTGCATGTTCTCTGCCTGG - Intronic
1060759914 9:126238383-126238405 CCAAGATCAAGGTGTCTGCCAGG - Intergenic
1061094696 9:128448930-128448952 TCAAGATCAAGGTGTCTGCAGGG - Intergenic
1203525265 Un_GL000213v1:83003-83025 CCAAGTTCCTGGTCTCCGGGAGG - Intergenic
1186610074 X:11130401-11130423 CCAAGATCAAGGTGTCAGCAGGG + Intergenic
1187119164 X:16386882-16386904 CCAAGATCATGTCCTTTGCAAGG + Intergenic
1187232920 X:17439792-17439814 TCAAGTTCATGATCTATGAATGG - Intronic
1187302206 X:18061666-18061688 GCAAGATCATGTTCTTTGCAGGG + Intergenic
1187424937 X:19168821-19168843 CCAAGATCAAGGTGCCTGCAGGG - Intergenic
1187436174 X:19271999-19272021 CCAAGATCAAGGTGTCTGCTGGG + Intergenic
1187892038 X:23945528-23945550 CCAAGATCAAGGTGTCTGCAGGG - Intergenic
1188032876 X:25284003-25284025 CCAAGATCAAGGTGTCAGCATGG + Intergenic
1188084669 X:25888701-25888723 CCAAATTCAAGGTGTCTGCAGGG - Intergenic
1188723060 X:33546602-33546624 ACAAGATCATGTTCTTTGCAGGG - Intergenic
1189295423 X:39914342-39914364 CCAAGATCAAGGTCTCTGCAGGG - Intergenic
1189345799 X:40240416-40240438 CCAAGATCAAGGTGTCAGCAGGG + Intergenic
1189375544 X:40463807-40463829 CCAAGATCAAGGTGTCAGCAGGG + Intergenic
1192137247 X:68614893-68614915 CAGAGTTCATGTCCTCTGCAGGG - Intergenic
1192824022 X:74675960-74675982 ACAAGATCATGTTCTTTGCAGGG + Intergenic
1192828445 X:74724400-74724422 ACAAGATCATGTTCTTTGCAGGG - Intergenic
1192976075 X:76287553-76287575 ACGAGTTCATGGTTTTTGCAGGG - Intergenic
1193269350 X:79511078-79511100 CCAAGATCAAGGTGCCTGCATGG - Intergenic
1194277743 X:91907944-91907966 ACAAGATCATGTTCTTTGCAGGG - Intronic
1194363137 X:92979508-92979530 ATAAGTTCATGTTCTTTGCAGGG + Intergenic
1194599164 X:95899350-95899372 CCAAGATCAGGGTGTCAGCAGGG + Intergenic
1194610433 X:96036305-96036327 CCAAATTCATGTTACCTGCATGG + Intergenic
1194725228 X:97388140-97388162 CCAAGATCAAGGTGTCAGCAGGG + Intronic
1195206590 X:102605690-102605712 CAAAGTTGATGGTCTCTCCTTGG + Intergenic
1195656738 X:107338592-107338614 CAAAGATCAAGGTATCTGCAGGG - Intergenic
1195882667 X:109609225-109609247 CTAAGTTCATGTCCTTTGCAGGG + Intergenic
1197106283 X:122720404-122720426 CCAAGACAATGGGCTCTGCAGGG + Intergenic
1197680829 X:129382674-129382696 ACAAGATCATGTTCTTTGCAGGG + Intergenic
1197822702 X:130557307-130557329 CCAAGATCAAGGTGTCTGCGGGG - Intergenic
1197863750 X:130996917-130996939 CACAGTTCATGGGATCTGCAGGG - Intergenic
1198406295 X:136315969-136315991 CCAAGGTCAAGGTGTCAGCAGGG - Intronic
1198524902 X:137491294-137491316 CCAAGATCAAGGTGTCAGCAGGG - Intergenic
1198685851 X:139227265-139227287 TCAAGATCATGGTGTCAGCAAGG - Intergenic
1200595083 Y:5130012-5130034 ACAAGATCATGTTCTTTGCAGGG - Intronic
1200671377 Y:6095754-6095776 ATAAGTTCATGTTCTTTGCAGGG + Intergenic
1200946424 Y:8844944-8844966 ACAAGATCATGTCCTCTGCAGGG + Intergenic
1201561002 Y:15316614-15316636 ATAAGTTCATGTTCTTTGCAGGG - Intergenic