ID: 1138056884

View in Genome Browser
Species Human (GRCh38)
Location 16:53844423-53844445
Sequence CTTTATAAGAACATGTAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 1, 2: 0, 3: 28, 4: 280}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138056884 Original CRISPR CTTTATAAGAACATGTAACT AGG Intronic
901692787 1:10984459-10984481 CTTTATAAGAAGAGGAAAATTGG - Intergenic
904177421 1:28640440-28640462 TTTTAGAGGCACATGTAACTGGG + Intronic
905721911 1:40211004-40211026 ATTTATAAAAACAGGTAGCTGGG - Intronic
906301723 1:44687257-44687279 CCTTATAAGAAGAGGTGACTAGG - Intronic
907079108 1:51604950-51604972 ATTTATAAAAACATGAAGCTAGG - Intronic
909068178 1:70961448-70961470 CTTTTTATGAACATGTGCCTTGG + Intronic
910165745 1:84325735-84325757 CTTTTCAGGAACAGGTAACTTGG + Exonic
910270840 1:85392295-85392317 CTTTATAAGAAGAGGAAATTTGG - Intronic
910301377 1:85710436-85710458 CTTTATAAGAAGAGGAAATTTGG + Intergenic
911802750 1:102163976-102163998 TTTTATGTGAAAATGTAACTGGG - Intergenic
914332076 1:146681420-146681442 ATTTAAAAGAACATGTAATTAGG - Intergenic
914949973 1:152104703-152104725 CCTTATAAGAAGATGAAATTTGG - Intergenic
915621231 1:157086106-157086128 CTTTATAAGCACATATCACCTGG + Intergenic
918226564 1:182488868-182488890 CTGCATAAGACCATGTAACAGGG + Intronic
919331623 1:196179534-196179556 CTTTTTAGGATCATGTACCTGGG + Intergenic
919628661 1:199937667-199937689 TTTTATATGAACATTAAACTTGG - Intergenic
920167872 1:204048740-204048762 CTTTATAAGAAATTGTGGCTAGG + Intergenic
920688278 1:208126618-208126640 CTTAATGAGGACAGGTAACTTGG + Intronic
921315882 1:213890048-213890070 TTTTATATGAACGAGTAACTAGG - Intergenic
921891821 1:220361253-220361275 CTTTATAAGAAGAGGCAATTTGG + Intergenic
1063421649 10:5916948-5916970 GTTTATAAGAGCTTGTCACTGGG + Intronic
1065228703 10:23574576-23574598 CTTTATAAGAAGAGGAAATTTGG + Intergenic
1066631631 10:37464228-37464250 TATTATAAGAACATGTATCAGGG - Intergenic
1067350605 10:45472288-45472310 GTTTATAAGAAGATGTTACTGGG + Intronic
1067993878 10:51246860-51246882 TTTCAGAAGAACATGTACCTTGG + Intronic
1068033549 10:51732224-51732246 CTTTATAAGAAAAGGAAATTTGG - Intronic
1068180626 10:53513515-53513537 CTTTATAAGAAAATGTAAAGAGG + Intergenic
1069169904 10:65213764-65213786 CTTGATAAGTAAAAGTAACTTGG + Intergenic
1069963369 10:72092556-72092578 CTTTATAAGAAGAGGGAATTTGG - Intergenic
1070009212 10:72455930-72455952 GATTATAAGAATATGTAGCTGGG + Intronic
1070548779 10:77474369-77474391 CTTTATAAGAACAGGAGATTAGG + Intronic
1070718243 10:78738314-78738336 CTTAATAACAACATGTATGTAGG - Intergenic
1071160337 10:82738184-82738206 TTTTATAAGAAAATGGCACTTGG + Intronic
1071644398 10:87347615-87347637 CTTTATGAGAACATGCAATATGG - Intergenic
1071731992 10:88257408-88257430 CTTTATAAGAACTTTAAATTGGG - Intergenic
1073606800 10:104903968-104903990 ATTTATATTAACATGTAACAGGG + Intronic
1073642939 10:105271277-105271299 CTTTATAAGAAGAAGAAACTAGG + Intergenic
1074326271 10:112455012-112455034 CTTTCAAACAACATGTACCTAGG - Intronic
1074336305 10:112579983-112580005 CTTTTTAAGAAAAAGTGACTGGG + Intronic
1074801117 10:117002616-117002638 ATTTGGAAGAACAGGTAACTGGG - Intronic
1075195753 10:120357541-120357563 CTATATAAGAACATAAACCTCGG - Intergenic
1075323169 10:121508741-121508763 TTTTATAAGAACACGAAACGGGG + Intronic
1076107041 10:127831913-127831935 CTTTATAAGAAGAAGAAATTAGG + Intergenic
1079640598 11:22800199-22800221 CTCCATAAGAACAAGTAACCTGG - Intronic
1080293832 11:30702253-30702275 CTGTATAAAAACATGGAAATTGG - Intergenic
1082933926 11:58637390-58637412 GTTTATATGAGCATGTCACTTGG - Intergenic
1083170288 11:60920184-60920206 CTTTATAAGCCCATGTTACTGGG + Intronic
1085798489 11:79565592-79565614 CTTTATAAGAAGAGGAGACTAGG + Intergenic
1086850514 11:91802134-91802156 CTTTGTAACAACATGTTACAAGG - Intergenic
1087517752 11:99186051-99186073 CTTTAAAAGAATATGTAACATGG - Intronic
1087702800 11:101455132-101455154 ATTTAAAAGAAAATGTAAGTAGG - Intronic
1088556931 11:111071265-111071287 CTTTATAAGAAGAGGAAATTAGG + Intergenic
1088775336 11:113077126-113077148 CTTTCTAGGAACCTGTAATTAGG + Intronic
1089566689 11:119375493-119375515 CTTTCTAGGAAAAGGTAACTGGG + Intronic
1090163956 11:124526692-124526714 GTCTATAAGAACATGAAAATAGG - Intergenic
1093589070 12:20877996-20878018 CTTCATAATAAAATGTGACTTGG - Intronic
1093830055 12:23744970-23744992 CTTTATAAGAAGAGGAAATTTGG - Intronic
1094247707 12:28320166-28320188 CTTTTTAGGAACATATAATTTGG + Intronic
1094787083 12:33860764-33860786 CTTTATCACAAAATGTCACTAGG - Intergenic
1095840616 12:46687764-46687786 CTTTTTAAAAAAATGTACCTAGG + Intergenic
1096129720 12:49148391-49148413 ATTTATAAAAACATGTAGCCGGG + Intergenic
1096730740 12:53610239-53610261 ATGTATGAGAACAGGTAACTAGG - Intronic
1097413531 12:59284391-59284413 CTTTGTAAGAAGAGGAAACTTGG - Intergenic
1097480725 12:60122148-60122170 CTTTTGAAGAACATCTAAATTGG + Intergenic
1097720955 12:63020924-63020946 CTTTTTAAGAACATGTGAAGGGG - Intergenic
1098114838 12:67164153-67164175 CTTTTCAAGAATATGTACCTTGG + Intergenic
1098352419 12:69577703-69577725 TTTTAGAAGAAGATGAAACTGGG - Exonic
1099419059 12:82430021-82430043 CTTTGTAAGAAAATGCAATTGGG - Intronic
1099849130 12:88070056-88070078 CTGTATCAGAAGATATAACTTGG + Intronic
1101071642 12:101081863-101081885 CTTTATAAGAAGAGGAAATTTGG - Intronic
1101179326 12:102195335-102195357 CTTTATAAGTACAAGCAAATTGG - Exonic
1102749322 12:115278448-115278470 CCTTATAAGAAGAGGCAACTAGG - Intergenic
1104796108 12:131520405-131520427 CATGTTAAGAACCTGTAACTGGG + Intergenic
1104947739 12:132424125-132424147 CTTTACAACAAAATCTAACTAGG - Intergenic
1105205940 13:18224351-18224373 CATTAAAAGAAAATGTGACTTGG - Intergenic
1106531749 13:30599693-30599715 CTTTATAAGAAGAGGAAATTTGG - Intronic
1106814360 13:33390413-33390435 CTTTGTTAGAACAAGTTACTAGG + Intergenic
1107740980 13:43450349-43450371 CTTTTTAAGAAAATGTACCTGGG + Intronic
1108297487 13:49038418-49038440 CCTTATAAGAACAGGAAATTAGG + Intronic
1110085811 13:71378191-71378213 CTTTATAATAAAGTATAACTTGG - Intergenic
1110325390 13:74208299-74208321 GTTTATAAGATCATGTTACAAGG - Intergenic
1110530493 13:76591830-76591852 CTTAATAAAAATATGTAACATGG + Intergenic
1110870204 13:80443392-80443414 CGAAATAAGAACATGAAACTGGG - Intergenic
1111070439 13:83159085-83159107 GTTTATAAGAACTTGAAAATTGG - Intergenic
1111900870 13:94198330-94198352 CTTTTTATGAATAAGTAACTTGG + Intronic
1113160539 13:107375890-107375912 CTTTATAAGAACATGACTATCGG - Intronic
1114593978 14:23895401-23895423 TTCTATAGGAACATGTTACTGGG - Intergenic
1114917166 14:27283140-27283162 ATTTTTAAGTTCATGTAACTTGG + Intergenic
1115665236 14:35537657-35537679 ATTTATAAGAAAATGAAATTGGG + Intergenic
1116381267 14:44271670-44271692 CTGTATAAGCACATTTAAGTAGG - Intergenic
1117270186 14:54135654-54135676 TTTTCGAAGTACATGTAACTGGG + Intergenic
1118742775 14:68752478-68752500 CTTTATAAGAAGAGGAAATTTGG + Intergenic
1119966062 14:78916948-78916970 CCTTATAAGAAGAGGAAACTTGG - Intronic
1121352808 14:93186783-93186805 CTTTTTAAAAACATGTGATTAGG + Exonic
1128822458 15:70671825-70671847 CTTCATCAGCACATGGAACTAGG - Intronic
1130006160 15:80100780-80100802 CTATATAAGGCCATGTAACATGG + Intronic
1130200343 15:81820095-81820117 TCTTATAAGAACATGTCATTGGG + Intergenic
1130303224 15:82696079-82696101 CTTTATAAGAAGAGGAAATTTGG - Intronic
1132274185 15:100552366-100552388 CTTTAAAAGACCATGAAGCTGGG - Intergenic
1135465157 16:22678586-22678608 CTGGCTAACAACATGTAACTAGG - Intergenic
1135816050 16:25634990-25635012 GTTTATAAGGGCATGAAACTTGG + Intergenic
1135923132 16:26669095-26669117 CTTTTTAAGAAGATGCAATTTGG - Intergenic
1138056884 16:53844423-53844445 CTTTATAAGAACATGTAACTAGG + Intronic
1138951080 16:61914041-61914063 CTTTATAAGAAGAGGTAATTTGG + Intronic
1140001474 16:71029498-71029520 ATTTAAAAGAACATGTAATTAGG + Intronic
1140686779 16:77441397-77441419 ATTTAGAAGAACATGTGACTGGG - Intergenic
1144133506 17:12270444-12270466 CATTATCTGAAAATGTAACTGGG - Intergenic
1144379642 17:14681627-14681649 CTTTGTGAGAAAATGTCACTGGG + Intergenic
1150736417 17:67744080-67744102 TTTTTTAAAAATATGTAACTGGG + Exonic
1153018350 18:604869-604891 CCTTATACGAACAGGGAACTCGG - Intronic
1153941635 18:9983277-9983299 TTTTATAAGAATATGCAACTGGG - Intergenic
1154052491 18:10974298-10974320 TTTTACAAGCACATGAAACTTGG - Intronic
1155326529 18:24670500-24670522 CCTTATAAGAAGAGGAAACTTGG + Intergenic
1155514673 18:26612472-26612494 CTTTGTAAGAAGAGGAAACTTGG + Intronic
1157017563 18:43735665-43735687 CCATATAAGAACATGTAAGAAGG - Intergenic
1157898708 18:51492930-51492952 CTTCATAAGAAGAGGTATCTTGG - Intergenic
1157915535 18:51660400-51660422 GTTTATAAGTACATGCAACTCGG - Intergenic
1158623795 18:59054786-59054808 CCTTATAAGAAGAGGAAACTTGG - Intergenic
1159132458 18:64295100-64295122 TTTGATAAGAACATGACACTAGG + Intergenic
1159242556 18:65760977-65760999 CTTATAAAGAACAAGTAACTTGG - Intronic
1164347579 19:27285417-27285439 ATTTAGAAGAATGTGTAACTAGG - Intergenic
1165671636 19:37684658-37684680 CTTTAAAAGAACCTATAATTTGG + Intronic
1167718702 19:51162287-51162309 CTTGATAAGAACATGGAGCATGG - Intergenic
925999908 2:9322336-9322358 CTTTGAAAGAACATGCTACTTGG + Intronic
927229362 2:20805334-20805356 CTTTATAAATACATGGAATTAGG - Intronic
928812815 2:35249429-35249451 CTTTATAACAATATGAAAATGGG - Intergenic
928893151 2:36229473-36229495 CTTTATAAGAGGAGGTAAATTGG - Intergenic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
929538041 2:42797086-42797108 CTTTACAAGAACATGTAACTAGG - Intergenic
931766694 2:65463207-65463229 CCTTATAAGAAGAAGTGACTAGG + Intergenic
932689579 2:73900917-73900939 CTTTATAAGAAGAGGGAATTAGG - Intronic
933252180 2:80041307-80041329 CATTATAAAAACTTTTAACTTGG - Intronic
933410122 2:81915030-81915052 CTTTAAAAAAATATGTAAGTAGG + Intergenic
936493771 2:112999404-112999426 CTTTAAAAGAACCTGTTACAAGG - Intergenic
936822010 2:116533355-116533377 CTTTATAAGAAGAGGAAATTTGG - Intergenic
938556889 2:132432582-132432604 CTTTATAAGAAAAAGAATCTTGG - Intronic
938638566 2:133255264-133255286 ATTTATAAGAACATTTATCCTGG - Intronic
939015235 2:136895434-136895456 CTTTTTAATACCATGTAAATGGG + Intronic
940073661 2:149717446-149717468 CCTTATAAGAAGATGAAATTAGG - Intergenic
940132772 2:150402753-150402775 ATTTCAAAGAACATGAAACTCGG + Intergenic
940297868 2:152147466-152147488 CTATATCACAACATGTAAATAGG - Intronic
940397202 2:153203423-153203445 CTTTTTAAGAACCAGGAACTAGG + Intergenic
941176719 2:162206137-162206159 CTTTAGATGAACAGGTAACTTGG + Intronic
941382319 2:164808883-164808905 CTTTTTAAGAATATGTGAGTGGG - Intronic
941629478 2:167867981-167868003 GTTTATAGGCAAATGTAACTAGG + Intergenic
942876047 2:180799639-180799661 TTTTATAAGTTAATGTAACTTGG + Intergenic
945070225 2:205981929-205981951 CTGTATAAGCACATGTGAGTAGG - Intergenic
946340611 2:219065144-219065166 CTTTCTTAGATCATCTAACTTGG - Intergenic
947280654 2:228450021-228450043 CTTTATAAGAAGAAGAAATTTGG + Intergenic
947597469 2:231422287-231422309 CTTTATAAGAAGAGGAAATTTGG - Intergenic
1169815906 20:9655898-9655920 CCTTATAAGAAAAGGAAACTTGG - Intronic
1170804586 20:19618433-19618455 CCTTATAAGAACAGGAAATTAGG - Intronic
1171751807 20:29059000-29059022 CTTTATTAGAACTTGGAACCCGG - Intergenic
1172002806 20:31793497-31793519 CTTCATTAAAACATGTGACTGGG - Intronic
1172341446 20:34161180-34161202 CTTTATAAGAAGAGGAAATTTGG - Intergenic
1173254519 20:41384696-41384718 CTTTATAAGAAGAGGAAATTAGG - Intergenic
1173720891 20:45257047-45257069 CTTTATGAAAACAGGTAACTAGG - Intergenic
1173936291 20:46868368-46868390 CCTTATAAGAAAATGAAATTTGG - Intergenic
1174187710 20:48718825-48718847 CTTTATAATAACCAATAACTAGG + Intronic
1174598384 20:51703245-51703267 CTTTATAAGAAGATATTATTGGG - Intronic
1174779673 20:53377557-53377579 CTTTATAAAAACAGGCCACTGGG + Intronic
1174895277 20:54442572-54442594 CTTTAAAATAAATTGTAACTTGG - Intergenic
1175635978 20:60584070-60584092 CTTTATAAGCACAGTGAACTTGG + Intergenic
1177207386 21:18025850-18025872 CCTTATAAGAACAGGAAATTTGG - Intronic
1177340844 21:19797740-19797762 CTATATAAGCACAGGTAAATTGG - Intergenic
1177776376 21:25571555-25571577 TTTGTTAAGAACATTTAACTTGG + Intergenic
1177899059 21:26891299-26891321 ATTTATCAGAAAATATAACTAGG - Intergenic
1178355154 21:31905150-31905172 CTTTATAAGAAGAGGAAATTTGG + Intronic
1179708939 21:43200735-43200757 CTTTATAAGAAGAGGAAATTAGG - Intergenic
1180760021 22:18194365-18194387 CATTAAAAGAAAATGTGACTTGG + Intergenic
1180770333 22:18378664-18378686 CATTAAAAGAAAATGTGACTTGG + Intergenic
1180775647 22:18430335-18430357 CATTAAAAGAAAATGTGACTTGG - Intergenic
1180775997 22:18484006-18484028 CATTAAAAGAAAATGTGACTTGG - Intergenic
1180808720 22:18741372-18741394 CATTAAAAGAAAATGTCACTTGG - Intergenic
1180828274 22:18881617-18881639 CATTAAAAGAAAATGTGACTTGG + Intergenic
1181071648 22:20346346-20346368 CATTAAAAGAAAATGTGACTTGG - Intergenic
1181194718 22:21175288-21175310 CATTAAAAGAAAATGTGACTTGG - Intergenic
1181214726 22:21317482-21317504 CATTAAAAGAAAATGTGACTTGG + Intergenic
1181890890 22:26062566-26062588 ATTTATTAGCTCATGTAACTAGG - Intergenic
1203232165 22_KI270731v1_random:119848-119870 CATTAAAAGAAAATGTGACTTGG + Intergenic
1203278370 22_KI270734v1_random:107622-107644 CATTAAAAGAAAATGTGACTTGG + Intergenic
949249865 3:1970969-1970991 CTTGTTAAGATCTTGTAACTTGG - Intergenic
949797339 3:7865316-7865338 CTTTATTAGAAATTGTACCTTGG + Intergenic
952068143 3:29597179-29597201 CTTTAAAAAAACATGTATTTTGG - Intronic
952331396 3:32367349-32367371 CTTTTTAAGAACTTGCAGCTAGG + Intronic
955256121 3:57333302-57333324 CTTAAAAAGAACATGTATCCGGG - Intronic
955926623 3:64012489-64012511 CTGCATAGGACCATGTAACTTGG + Intronic
957239249 3:77637156-77637178 CTTTAAAATTACCTGTAACTGGG - Intronic
957437694 3:80200293-80200315 ATTTATAAGAAATTGTATCTTGG + Intergenic
957514107 3:81229313-81229335 CCTTAGAAAAACATGTAAGTGGG + Intergenic
958089058 3:88852111-88852133 GCATATAAGAACATGTAACTTGG + Intergenic
958706358 3:97661558-97661580 CTTTTTAAGAACACAAAACTGGG + Intronic
959764944 3:110014385-110014407 TTATATAAGTACATGTAACTTGG + Intergenic
959771633 3:110105958-110105980 CTTTATAAAAAGATATAAGTTGG - Intergenic
963649595 3:147962066-147962088 ATTAATAAGAACATGTAGTTGGG - Intergenic
963748298 3:149148329-149148351 CTTTATAGAAACGTGTAAGTAGG + Intronic
964323595 3:155523436-155523458 CTCTTTAAGAAAATGTACCTTGG - Intronic
965812235 3:172603126-172603148 TTAGATAAGAACATATAACTTGG + Intergenic
966380083 3:179336089-179336111 CTTTATAAAAACAAGAAATTTGG - Intergenic
966489609 3:180513355-180513377 TTTAATAAAAACTTGTAACTAGG + Intergenic
967123743 3:186406607-186406629 CTTTCTAACAACATGTGACCTGG + Intergenic
970841477 4:20476627-20476649 AGTTATAAGAACTTATAACTTGG + Intronic
972308190 4:37852515-37852537 CTTTCTGAGAACAAGTAATTGGG + Intronic
974344665 4:60663356-60663378 GTTTATTAGAAAATATAACTGGG + Intergenic
974431985 4:61810437-61810459 CTTTATAGAACCATGGAACTAGG - Intronic
974450155 4:62044657-62044679 CATTGTAAGAACATAAAACTTGG + Intronic
976250745 4:83049489-83049511 CTTTATAAGCAAATGTCAGTTGG - Intronic
977853716 4:101861390-101861412 TTTTATAAGAGCATATAAATGGG + Intronic
978279860 4:106998076-106998098 CTTTTTGTGAACATGTAAGTAGG + Intronic
978606670 4:110487984-110488006 CTTTACATGAAAATGAAACTGGG + Intronic
978633127 4:110770435-110770457 CTCTACAAGATCATGTAAATGGG - Intergenic
979625451 4:122840026-122840048 CTTTATAAGAAGAGGAAACCTGG - Intronic
980534717 4:134102842-134102864 GTTTATAAGTACATGTAAAATGG + Intergenic
980573132 4:134649286-134649308 TTTTATAAGAACATGTATCCTGG - Intergenic
982418786 4:155168956-155168978 CTATATAAGAAAATGTAGGTAGG - Intergenic
982538334 4:156635755-156635777 CTTTTTAAAATCTTGTAACTAGG - Intronic
982715868 4:158807199-158807221 GTTTATAAGTGCATTTAACTTGG + Intronic
983982884 4:174020762-174020784 GTTTAAAAGAACATATATCTTGG + Intergenic
987832473 5:23113887-23113909 ATTGATAAGAAAATGTAACAAGG - Intergenic
987954775 5:24724776-24724798 TTTTATAAGTACATTTAACATGG - Intergenic
988075454 5:26347680-26347702 TTTTATAAAAACATCTAAGTAGG - Intergenic
989094618 5:37770297-37770319 CTTTATAAGAAGAGGAAATTTGG + Intergenic
990255052 5:53959492-53959514 ATTTATTAGAACCTGAAACTAGG - Intronic
990417712 5:55601872-55601894 CTTTATAAGAAGGGGAAACTTGG + Intergenic
992416637 5:76558320-76558342 CTTTATAACAACCTGGAAATTGG - Intronic
993432354 5:87847425-87847447 CTTTAAAAAAAAATGTAGCTTGG - Intergenic
993693378 5:91030851-91030873 CTTTTCAAAAACATGTAATTAGG - Intronic
995366931 5:111372614-111372636 ATTTATTGGCACATGTAACTGGG - Intronic
995610734 5:113908099-113908121 CTTTATAAGAACAGGAAGTTTGG + Intergenic
997774911 5:136594745-136594767 CCTTATAAGAATATGAAATTTGG - Intergenic
997788500 5:136735791-136735813 GTTTATAAGGAATTGTAACTGGG - Intergenic
1001417744 5:171558974-171558996 CTTTATTAGAACAAGGAGCTAGG - Intergenic
1002948150 6:1782220-1782242 CTTTTTAAATACATGTAACTGGG - Intronic
1003466226 6:6382684-6382706 CCTTATAAGAAGAGGAAACTTGG - Intergenic
1004835314 6:19524474-19524496 CTTTATGAGAACAGGCAACAGGG - Intergenic
1006371420 6:33646269-33646291 CCATATAAGAAAATCTAACTAGG + Intronic
1006789170 6:36687362-36687384 CCTTATAAGAACAAATAAATGGG + Intergenic
1009595720 6:65732972-65732994 CTTTCTAATACCATGTAATTAGG + Intergenic
1009736522 6:67683309-67683331 CTTTTTATGAGCATGTAATTTGG + Intergenic
1011641694 6:89421806-89421828 ATTTGTAAGAACATGGTACTTGG + Intergenic
1012020545 6:93912981-93913003 CTTTATAAAAACTTTTAAATTGG + Intergenic
1012838789 6:104303240-104303262 CTTTATGAAAATATGTTACTTGG + Intergenic
1013982736 6:116151923-116151945 TTTTATAAGAACATGTTATTTGG + Intronic
1014055585 6:117011561-117011583 CTTTATTAAAACATGTATGTAGG - Intergenic
1014696196 6:124624102-124624124 CTTCTTAAGAGCATGTAAGTGGG - Intronic
1014961931 6:127696828-127696850 CTTTATAAGAAAAGGAAATTTGG - Intergenic
1017787842 6:157771270-157771292 AATTATAAGAACAGGAAACTTGG + Intronic
1018035098 6:159874984-159875006 CTTTATAAGAAGAGGAAATTAGG + Intergenic
1019840532 7:3438260-3438282 CTGCATAAAAACATTTAACTAGG + Intronic
1021317605 7:19169455-19169477 TTTTATAACAAGATGTATCTAGG + Intergenic
1021330927 7:19338712-19338734 CTTTTTAATAACTTGTAACCTGG + Intergenic
1026076229 7:67171975-67171997 CTTTTTAATAACATGTAATTGGG + Intronic
1026108903 7:67443052-67443074 CTTTATAAGAAGAGGAAATTTGG + Intergenic
1026700628 7:72640315-72640337 CTTTTTAATAACATGTAATTGGG - Intronic
1027005765 7:74691506-74691528 TTTTAGAAGAAAATATAACTTGG - Intronic
1027492299 7:78844139-78844161 CTTTTTAAGAATTTGTGACTAGG - Intronic
1028553084 7:92093331-92093353 CTTATTAAAAACATGTAACAAGG + Intronic
1028814059 7:95123694-95123716 ATCTTTAAGAAAATGTAACTAGG + Intronic
1030514741 7:110525613-110525635 ATTCATAAGAACAGGTACCTGGG + Intergenic
1030934346 7:115566283-115566305 CTATAAAAGGACATGCAACTAGG - Intergenic
1031415137 7:121486486-121486508 CCTTATAAGAACAAGAAATTTGG - Intergenic
1032932357 7:136688102-136688124 TTTTTTTAGAACATGTATCTTGG + Intergenic
1032981722 7:137291893-137291915 CTTGAGAAGTAGATGTAACTTGG + Intronic
1033395416 7:140969773-140969795 CTTTTTAAGTTCATGTGACTTGG - Intergenic
1034135903 7:148769366-148769388 CTTTAAAGGAACATTTAGCTTGG - Intronic
1035846030 8:2865265-2865287 CTTTATAGAAGCATTTAACTTGG - Intergenic
1038368291 8:26960663-26960685 CTTTATAAGAAGAGGAAATTAGG + Intergenic
1038825686 8:30998322-30998344 CTTCAGAAAAACATGTAACTAGG + Intronic
1041954248 8:63539916-63539938 CTTTATAAGAAGAGGAAATTAGG + Intergenic
1042017704 8:64334256-64334278 GTTTATTATAACATGTAAATAGG + Intergenic
1043059700 8:75484580-75484602 TTTTGTGAGAACATGTAACTGGG - Intronic
1044396873 8:91722951-91722973 CTTAATAAGAAAATGTATTTTGG + Intergenic
1044802613 8:95972682-95972704 CTTTATAAGAAAAGGTGATTAGG - Intergenic
1044884576 8:96763101-96763123 CTTTATAAGAAGAGGAAAGTTGG - Intronic
1044964106 8:97558231-97558253 ATTTATAAGAACATGTGGCTGGG - Intergenic
1046410695 8:113838682-113838704 TTTTATAAGGACATGTAAGAAGG - Intergenic
1046615517 8:116472946-116472968 CTTTAACAGAATATTTAACTAGG + Intergenic
1046885478 8:119362269-119362291 ATTTATAGGAAAATGTCACTCGG - Intergenic
1047040205 8:120985476-120985498 TTTTCTAAAAACATGTATCTTGG - Intergenic
1047471872 8:125182321-125182343 CTTTATAAAATCAGTTAACTGGG - Intronic
1048559758 8:135521296-135521318 ATTAATAAGAACATGAAGCTGGG + Exonic
1049870915 8:144975200-144975222 CTCTAGAAGAAGTTGTAACTGGG + Intergenic
1050583852 9:7089666-7089688 GTTTATGGGAACATGTAACTTGG - Intergenic
1050623150 9:7475567-7475589 TTTTTTAAAAAAATGTAACTGGG + Intergenic
1052018670 9:23499542-23499564 TTTTTTAAGCAAATGTAACTGGG + Intergenic
1052307119 9:27023076-27023098 CTTGATATGATCATATAACTAGG - Intronic
1052829820 9:33205923-33205945 GTTTATGAGAACATGTAACAAGG - Intergenic
1053114914 9:35491636-35491658 CTTTATAAAGACATGTAAGAGGG - Intronic
1055051867 9:71989497-71989519 CATTATAACAACATTTAATTGGG + Intergenic
1055234741 9:74107172-74107194 CATTGTAAGAACATTTACCTTGG + Intergenic
1055538088 9:77269905-77269927 CTTTATAAGAAAAGGAAATTTGG + Intronic
1056052737 9:82786770-82786792 CTATATAAGAACACGTGATTTGG - Intergenic
1056161665 9:83901915-83901937 CTTTATATTAACATGGAATTGGG + Intronic
1056358464 9:85827291-85827313 CTTTATATTAACATGTAATTGGG - Intergenic
1058483083 9:105416659-105416681 CTTTATAAGAACATATTATTTGG - Intronic
1058607563 9:106739691-106739713 CTTTAAAAGAACAAGTGACATGG - Intergenic
1060612294 9:124978563-124978585 CTTTAGAAGACAATTTAACTTGG + Intronic
1188384942 X:29544933-29544955 CCTTATAAGAAGATGAAATTAGG + Intronic
1188665003 X:32808323-32808345 CTTGATAAGCACATGTACTTGGG - Intronic
1188716719 X:33467398-33467420 CCATATAAGATGATGTAACTGGG - Intergenic
1189288470 X:39868517-39868539 CTTTATAAGAAGAGGAAATTAGG - Intergenic
1189483303 X:41409585-41409607 AGTTATAAAAACATGTAACAAGG + Intergenic
1193162006 X:78238832-78238854 CTTTATAAGAACAAAAAATTAGG - Intergenic
1195174100 X:102297994-102298016 CTTTATAAGAAGAGGAAAATTGG + Intergenic
1195184765 X:102389099-102389121 CTTTATAAGAAGAGGAAAATTGG - Intronic
1197517593 X:127454252-127454274 ATTTATAAGAACATGGATTTGGG + Intergenic
1199381613 X:147178741-147178763 CTTTGTAAGAACATGGAAGGGGG + Intergenic
1199605115 X:149571571-149571593 CTTTATAACAGGATGCAACTGGG - Intergenic
1199667946 X:150116745-150116767 TTTTTTAAAAATATGTAACTGGG + Intergenic
1201411935 Y:13707247-13707269 CTTTATAAAAACATTCAGCTGGG - Intergenic