ID: 1138057753

View in Genome Browser
Species Human (GRCh38)
Location 16:53853477-53853499
Sequence CTGGAGATTCAGAAGAGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 646
Summary {0: 1, 1: 3, 2: 17, 3: 84, 4: 541}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138057753 Original CRISPR CTGGAGATTCAGAAGAGAGG AGG (reversed) Intronic
901183156 1:7355664-7355686 CTGGAGCATCTGAAGACAGGAGG - Intronic
901234627 1:7661305-7661327 GTGGAGACTCAGGATAGAGGTGG - Intronic
901513221 1:9728538-9728560 CTGGTGAATCAGAACAGAGCTGG - Exonic
902765955 1:18615395-18615417 CTGGAAATTCAGAACAGAATAGG + Intergenic
903429719 1:23285512-23285534 CTTGAGACTCAAAACAGAGGGGG + Intergenic
905273912 1:36805084-36805106 CTGGGGATCCAGAAGATCGGGGG - Exonic
905392095 1:37643056-37643078 CTGGGGATTCAGGAGAGACAAGG - Intergenic
905430502 1:37919298-37919320 CTGGTGACTGAGAAGATAGGAGG - Intronic
905975074 1:42168610-42168632 CTGGAGGTTCAGAGGGGAGGGGG - Intergenic
906413510 1:45599598-45599620 TTGTATTTTCAGAAGAGAGGGGG + Intronic
906477398 1:46178972-46178994 CTGAAGAGACAGAAGAGAGAGGG - Intronic
906624141 1:47311239-47311261 TTTGAAACTCAGAAGAGAGGTGG - Intronic
906669457 1:47643917-47643939 ATGGAGAGTCAGAAGACAGCAGG - Intergenic
906690524 1:47789856-47789878 CTGATGATACAGGAGAGAGGGGG - Intronic
906882199 1:49603719-49603741 CTGGAGACTCAGAATGGGGGAGG - Intronic
908250607 1:62262853-62262875 CCAGAGAGTCAGAAGAGGGGAGG + Intronic
908256669 1:62308897-62308919 CAGGAGAATCAGAAGTCAGGGGG - Intronic
908959377 1:69676936-69676958 CTGGAGACTCAGAAGGGAAAGGG - Intronic
909170056 1:72283063-72283085 CTGGGGATGGAGAAGGGAGGGGG + Intergenic
910273378 1:85421003-85421025 CTGGTGCTTCACAAGAGAGAAGG + Intronic
911105670 1:94129598-94129620 CTGAAGATTGAGAAGAAAGTTGG - Intergenic
911426336 1:97718518-97718540 CTGAAAATTCAGAATTGAGGTGG + Intronic
912492901 1:110071627-110071649 CTGACGATTCAGAAGGGATGAGG + Intronic
912897194 1:113604807-113604829 TTGAAGATTCAGAAGGGAGGAGG + Intronic
912994845 1:114522377-114522399 TTGGACATTCAGAGGAGAGGCGG + Intergenic
913008641 1:114660456-114660478 CTGGACATTCAGAAGAAAGCAGG + Intronic
913600153 1:120414860-120414882 CTGGTGCTTTAAAAGAGAGGCGG + Intergenic
914086908 1:144461804-144461826 CTGGTGCTTTAAAAGAGAGGCGG - Intergenic
914311702 1:146472409-146472431 CTGGTGCTTTAAAAGAGAGGCGG + Intergenic
914590712 1:149103696-149103718 CTGGTGCTTTAAAAGAGAGGCGG - Intergenic
915596460 1:156899277-156899299 AGGGAGATGGAGAAGAGAGGAGG + Intronic
916291051 1:163166574-163166596 CTGTGGATTCAGAAGAGAGTGGG + Intronic
916415389 1:164587883-164587905 CAGGAGATTCAGAAAAGGGGTGG - Intronic
916453244 1:164941860-164941882 TTGGAGACTCTGAAGGGAGGAGG - Intergenic
916577736 1:166082217-166082239 CTAGAGAGCCAGAAGGGAGGGGG - Intronic
916634506 1:166653811-166653833 CAGGAAATTCAGAAAAGAGTTGG + Intergenic
917043488 1:170831829-170831851 TTGGAGTTTCAGAAGTGGGGAGG - Intergenic
918091315 1:181297479-181297501 CTGAAGCATCAGAAGGGAGGGGG + Intergenic
918485075 1:185020298-185020320 CTGGAGTCTCAAAAGAGAAGAGG - Intergenic
918521957 1:185424441-185424463 TTGGAGTTTCAGTAGAGAAGAGG - Intergenic
918928876 1:190826700-190826722 ATGGAGATTCAGAAGGGTGAGGG + Intergenic
919098608 1:193066219-193066241 CTGAAGATACAGTAGAGAAGGGG - Intronic
919171598 1:193961184-193961206 CTGAAGATTAAGCAGAGAGATGG - Intergenic
919613993 1:199782164-199782186 TTGGAGACTGAGAAGAGGGGGGG + Intergenic
920195473 1:204223505-204223527 GTGGGGATTCAGACGACAGGGGG + Exonic
920656480 1:207879349-207879371 GTGGAGAATGAGAAGAGATGAGG - Intergenic
920894667 1:210034596-210034618 CTGAAGATTCAGAAAAGTGGAGG - Intronic
921483107 1:215686298-215686320 CTTGTTATTCAGAAGAAAGGGGG + Intronic
922162713 1:223090157-223090179 CTGGAGAGCCAGATGAGGGGAGG - Intergenic
922202162 1:223413835-223413857 CAGGAGACTCAAAAGTGAGGAGG + Intergenic
922647199 1:227300658-227300680 GTGGAGACTCAGAAGGGAGAAGG + Intronic
923159325 1:231303378-231303400 CAGGAGGTTCATAAGGGAGGTGG - Intergenic
923274480 1:232384590-232384612 CTGGAGGTGGAGAAGAAAGGAGG + Intergenic
923743393 1:236677044-236677066 CTGGAGCTCCAGAAGAAAGGTGG + Intergenic
1063006256 10:1973386-1973408 CTGGAGATTAAGAGGCTAGGTGG + Intergenic
1063608042 10:7540124-7540146 CTGGAGATAAAAAGGAGAGGGGG + Intergenic
1063810012 10:9694015-9694037 ATGGATTTTCAGAAGAAAGGGGG - Intergenic
1063953863 10:11247916-11247938 CTGGGTCTTCAGAACAGAGGAGG - Intronic
1064020086 10:11801977-11801999 CTGGAGACTCAGAAGGAGGGAGG + Intergenic
1064235569 10:13571079-13571101 TTAGAGATTCAGAAGGAAGGAGG + Intergenic
1064321720 10:14311194-14311216 GTGGAAATTCAGGAGACAGGTGG - Intronic
1064468360 10:15608920-15608942 CTGGAGGTTGAGACGAGAAGAGG + Intronic
1064594216 10:16926984-16927006 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1064707938 10:18092171-18092193 CTGAAGATACACAAGAGAAGGGG - Intergenic
1064931989 10:20638631-20638653 CTGATGATTCAGAAGTGAGAGGG + Intergenic
1064955500 10:20903856-20903878 ATGGAGACTCAGAAGGGAGAAGG + Intronic
1065165148 10:22968375-22968397 GTGCAGATTCAGCAGACAGGGGG + Exonic
1065679301 10:28212666-28212688 TAGGCGATGCAGAAGAGAGGAGG + Intronic
1066422734 10:35277496-35277518 CTGGAGAGTAGGCAGAGAGGAGG - Intronic
1066597788 10:37071062-37071084 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1066695025 10:38069629-38069651 CTGGAGAATCAGAAGACTTGGGG + Intergenic
1067740928 10:48895753-48895775 CCAGAGAAGCAGAAGAGAGGAGG - Intronic
1067794925 10:49313950-49313972 CTGTAGAGTGAGAAGAGAAGAGG + Intronic
1068419146 10:56766634-56766656 CTGGAGGTACAGAATAGAGCAGG - Intergenic
1068431841 10:56943117-56943139 CTGGAAATTCAGAAATGAAGAGG - Intergenic
1068553280 10:58429594-58429616 ATGGAGACTCAGAAGAGTGAAGG - Intergenic
1069132855 10:64728002-64728024 ATGGAGATTAAGAACAGAGAAGG - Intergenic
1069547442 10:69338833-69338855 CTGGAGATGCTGTGGAGAGGAGG + Intronic
1070519318 10:77238094-77238116 CTGGGAATTCAGATGAGATGAGG + Intronic
1070747635 10:78944291-78944313 CTGGTGCTGCAGAAGAGAGAGGG + Intergenic
1072730700 10:97844330-97844352 CTGATGATTCAGAAAAGAGAGGG - Intergenic
1073149731 10:101303527-101303549 CTGGAGATGAAGCAGGGAGGGGG - Intergenic
1073689410 10:105790971-105790993 CTGAAGATTCAGGAGAGAAGTGG - Intergenic
1073932942 10:108597794-108597816 CTGGAGATTCAGAAGGTACAGGG - Intergenic
1074210448 10:111328269-111328291 CTGGAGACTCCGAAGGGAGTGGG + Intergenic
1074292645 10:112151040-112151062 TAAGTGATTCAGAAGAGAGGAGG - Exonic
1075987653 10:126801404-126801426 CTGGAGACTCAGAAGGGTGGGGG - Intergenic
1076171576 10:128324327-128324349 CTGGAGAGTCAGAAGTCAGAGGG - Intergenic
1076271739 10:129158517-129158539 ATGGAGAAGGAGAAGAGAGGTGG + Intergenic
1076329154 10:129652310-129652332 CTGGAGTTCCAGTAGAGTGGAGG + Intronic
1076451128 10:130557676-130557698 CTGGAGGGACAGGAGAGAGGAGG + Intergenic
1076520926 10:131080800-131080822 CTGGAGATTCAGAAATGTGGAGG + Intergenic
1077439828 11:2562624-2562646 CTGGAGACTCTGAAGAGGGGTGG - Intronic
1078502942 11:11901012-11901034 CTGGGGATTGAGAATAGAAGAGG + Intronic
1079348087 11:19670371-19670393 CCGGAGATGCAGCAGTGAGGAGG - Intronic
1079380412 11:19933153-19933175 CTGCAGAGACAGAAGAGAGGAGG - Intronic
1079472281 11:20789916-20789938 CTTAAGTTTCAGCAGAGAGGAGG + Intronic
1079500496 11:21096485-21096507 CTGGGGCTTCAGAAGAGAAAGGG - Intronic
1079791875 11:24748629-24748651 TTGTATTTTCAGAAGAGAGGGGG + Intronic
1080609292 11:33890128-33890150 CTGGAGACTCAGAAGGGTGGGGG + Intronic
1080898780 11:36467804-36467826 CTGGAGAAAAAGGAGAGAGGCGG - Intergenic
1080971354 11:37280781-37280803 GTGAAGATACAGAAGAGAGAAGG - Intergenic
1081181836 11:39993191-39993213 CTGGTGATTTATAAGAGAGGAGG - Intergenic
1081405808 11:42696267-42696289 CTGGAGACTCAGAAGAGGGGAGG + Intergenic
1081855154 11:46298344-46298366 CTGGTGGGTCAGAAGAGATGGGG - Intronic
1082255027 11:50024529-50024551 CTGGAGACTCAGAAGCGGGAAGG - Intergenic
1082936344 11:58660801-58660823 CTGTATATTTAGTAGAGAGGGGG - Intronic
1083132662 11:60640300-60640322 CTGGAGACTCAGAAGCGGGAGGG + Intergenic
1084004082 11:66314118-66314140 CTGGTGATTCAGAGGAGTGAAGG - Intergenic
1084182536 11:67454103-67454125 CTGGAGCTGCTAAAGAGAGGGGG + Intronic
1084383786 11:68829522-68829544 CTGGAAAGGCAGAAAAGAGGAGG + Intronic
1084740527 11:71136475-71136497 CAGGAGACTCAGAAGGGTGGTGG + Intronic
1085254998 11:75167513-75167535 CTGGAGAGTCAGAACAGGAGGGG - Intronic
1085553628 11:77399363-77399385 GTGAAGTTTCAGAAAAGAGGTGG + Intronic
1085886334 11:80526724-80526746 CTGGAGACCCAGAAGAGGGGAGG + Intergenic
1085892014 11:80591283-80591305 TTGGAGATTCAAAAGTGGGGAGG + Intergenic
1086904924 11:92407304-92407326 CTGGAGCTGCAGTAGTGAGGGGG + Intronic
1087876285 11:103361919-103361941 CTGGATATTCAGAATAAAAGTGG + Intronic
1088472520 11:110201608-110201630 CTGGATATTCACAACACAGGAGG + Intronic
1088798389 11:113283887-113283909 GTGGACCTTCAGGAGAGAGGAGG - Intergenic
1089105499 11:116000048-116000070 TTGTAGATTGAGAAGAGAGAGGG + Intergenic
1089126213 11:116178277-116178299 CTGGAGACGCAGAAGAGCTGAGG - Intergenic
1089504263 11:118953155-118953177 TAGGAGATTTGGAAGAGAGGAGG + Intronic
1089813606 11:121152564-121152586 CTGGAGATTCAGATGGGCGGTGG + Intronic
1090136359 11:124203564-124203586 CTGGGGAGTCAGAAGAAAGGAGG + Intergenic
1090320983 11:125843378-125843400 TTGGAGATTCCGAAGAGGGGAGG - Intergenic
1090405365 11:126473136-126473158 GTGGAGGTTAAGTAGAGAGGGGG - Intronic
1091026342 11:132144775-132144797 CTGGCAATGCAGATGAGAGGTGG - Intronic
1093017803 12:14171985-14172007 CTGGAGATTAAGATATGAGGAGG - Intergenic
1093392853 12:18644026-18644048 CTGGATATTAAGGAGAAAGGAGG - Intronic
1093456649 12:19371465-19371487 TTGGAGACTCAGAAGGGAGAGGG - Intronic
1095088075 12:38079841-38079863 CTGGAGTGTGAAAAGAGAGGAGG - Intergenic
1096615036 12:52827432-52827454 CTAAACATTCAGAAAAGAGGGGG + Intronic
1096854719 12:54472313-54472335 CTGAAGATTGGGATGAGAGGAGG - Exonic
1098081607 12:66791834-66791856 CTGGAGACTCAGAAGCAGGGAGG - Intronic
1098480314 12:70950286-70950308 TTGGAGACTCAGAAGGGATGAGG - Intergenic
1098504857 12:71237619-71237641 CTGGAGATAGAAAAAAGAGGAGG - Intronic
1099248504 12:80222710-80222732 CTAGAAATTCAGAAGATAGTAGG - Intronic
1100762555 12:97825327-97825349 TTGGAGAATCAGAAGGGAGTGGG - Intergenic
1100893853 12:99157643-99157665 CTGGAGACTCAGAAAGGGGGAGG + Intronic
1101059891 12:100959820-100959842 ATGGAGATACAGAAGAAAAGGGG - Intronic
1101464474 12:104933906-104933928 CTGGAGACTCAGAAAGGGGGAGG + Intronic
1102897308 12:116608953-116608975 CTGGAGACTCAGAAGCGGGGCGG + Intergenic
1104536616 12:129623432-129623454 TTAGAGACTCAGAAGAGGGGAGG - Intronic
1105464804 13:20629243-20629265 CTAGAGATTCAAAACAGTGGTGG + Intronic
1105592263 13:21803604-21803626 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
1105747205 13:23388716-23388738 CTGGAGACTCAGAAGCAGGGAGG + Intronic
1106043037 13:26112062-26112084 CTGAAGTATGAGAAGAGAGGAGG + Intergenic
1107586771 13:41858087-41858109 CTGGAGAGCCAGGAAAGAGGTGG - Intronic
1107805216 13:44147283-44147305 TGGGAGAGTCAGAAAAGAGGAGG - Intronic
1107913375 13:45125652-45125674 CTAGAGATTCAGAGGTGAGGTGG + Intronic
1108096691 13:46909118-46909140 CTGGAGACTCAGAAGTGAGGAGG - Intergenic
1108738994 13:53315143-53315165 TTGGAGACTCAGAAGAGGGAGGG + Intergenic
1108875948 13:55051301-55051323 CTGGAGATTCAGAAGAGAGAAGG + Intergenic
1108976642 13:56452319-56452341 TTGGAGACTCAGAATAGGGGAGG - Intergenic
1109598923 13:64597301-64597323 CTAAAGCTTCAGAAGAGAAGAGG - Intergenic
1110002372 13:70220332-70220354 GTGGAGAGTCATAAGAGATGAGG + Intergenic
1110670482 13:78171193-78171215 CTGGAATTTCAGAATAAAGGTGG + Intergenic
1110685707 13:78371483-78371505 CTGGCTATTCAGAATTGAGGAGG - Intergenic
1110745389 13:79047431-79047453 CTGGAGATTTGGAGGAGGGGAGG + Intergenic
1110860943 13:80343555-80343577 CTGGAGATTGTGAGGAAAGGGGG - Intergenic
1112137371 13:96596101-96596123 CTGGAGATTCACAAGGGGAGAGG - Intronic
1112167365 13:96933894-96933916 CTGGTGATGCAGGAGAGAGAAGG + Intergenic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1113063795 13:106354226-106354248 CTGGAGCTTGGGAAGACAGGAGG + Intergenic
1113281762 13:108796170-108796192 TGGGAAGTTCAGAAGAGAGGAGG + Intronic
1114648809 14:24270325-24270347 CTGGAGACTCAGAAGTGCGTAGG - Exonic
1116042001 14:39697407-39697429 TTGGAGACTCAGAAGGGGGGAGG - Intergenic
1116693851 14:48147220-48147242 CTGGAGACTCAGAAGGGCAGAGG + Intergenic
1116754774 14:48933362-48933384 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1116762786 14:49035343-49035365 CTGGAGATTCAGAAGGGTGGGGG + Intergenic
1117074518 14:52088952-52088974 CTAGAGACTCAGAAGACTGGAGG - Intergenic
1118487191 14:66225102-66225124 CCGGAGAACCAGAAGAGGGGTGG - Intergenic
1119395004 14:74319795-74319817 CTGTAGATTGAGAAGAAAAGAGG + Intronic
1119746001 14:77044407-77044429 CTGAGGACTCAGAAAAGAGGGGG - Intergenic
1119801954 14:77453448-77453470 CTTGATTGTCAGAAGAGAGGTGG - Intronic
1119885265 14:78135200-78135222 CTGGAGATTCAAAGTAGATGGGG + Intergenic
1120139588 14:80913755-80913777 GTGGAGACTCAGAAGGGAGGAGG + Intronic
1121085866 14:91145639-91145661 CTGGAGATGCAGGTGTGAGGAGG - Intronic
1121351746 14:93178944-93178966 CTAGAGACTAAGGAGAGAGGTGG - Intergenic
1122253197 14:100455438-100455460 ATTGAGCTCCAGAAGAGAGGAGG + Intronic
1122760791 14:104023939-104023961 CTGGAGATTGGGAAAAGAGTTGG + Intronic
1123476179 15:20593764-20593786 CTGGGGATTCAGCAGGGACGTGG - Intergenic
1123641833 15:22406600-22406622 CTGGGGATTCAGCAGGGACGTGG + Intergenic
1124117713 15:26862915-26862937 CTGGAGACTTAGAAGGGAGAAGG + Intronic
1125070428 15:35547013-35547035 GGGGAGAGTCAGGAGAGAGGTGG + Intergenic
1125552973 15:40561534-40561556 TTGGAGATTCAGAAGTGGGGAGG + Intronic
1125929619 15:43591004-43591026 CTGTATATTCAGTAGAGACGGGG - Intergenic
1125942786 15:43690836-43690858 CTGTATATTCAGTAGAGACGGGG - Intergenic
1126481563 15:49128029-49128051 CTGGATCATCAGAAGAGGGGTGG - Exonic
1126552027 15:49942026-49942048 TTGCAGATTCAGAAGTGAGGAGG + Intronic
1127456398 15:59159475-59159497 CTGGAGTGTCAGGAGGGAGGTGG + Intronic
1127681306 15:61301244-61301266 CTGGAGTTTCGGAAGAAAAGTGG + Intergenic
1127714545 15:61636719-61636741 TTGGGGACTCAGAAGGGAGGTGG + Intergenic
1128159951 15:65417076-65417098 CCTGAAATTCAGAAGTGAGGAGG - Intronic
1129291029 15:74567764-74567786 CTGGAGCTTTAGAAGAAAGGAGG + Intronic
1129585630 15:76861516-76861538 ATAGAGATACAGAAGACAGGAGG - Intronic
1129698260 15:77752914-77752936 CTAGAGAGGCAGAAGGGAGGGGG - Intronic
1130043073 15:80421240-80421262 TTGGAGACTCAGAAGGGTGGAGG + Intronic
1130340070 15:82992685-82992707 CAGGAAGCTCAGAAGAGAGGTGG + Intronic
1130361063 15:83186717-83186739 CTGGAGATTCAGAAGGGAAGAGG + Intronic
1130374418 15:83315522-83315544 TTGGAGACTCAGAAGCGGGGAGG + Intergenic
1130678798 15:85978375-85978397 CTTAACATGCAGAAGAGAGGTGG - Intergenic
1130825469 15:87540572-87540594 CTGGAGACTCAGAAGGTAGGAGG + Intergenic
1130940963 15:88508681-88508703 CTGCAGTTTCAGAGGAGGGGTGG + Intergenic
1131329377 15:91482519-91482541 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1133542090 16:6765962-6765984 TTGGAGACTCAGAAGATGGGAGG + Intronic
1133581643 16:7150004-7150026 CTGTTGAGTCAGAACAGAGGTGG - Intronic
1134740667 16:16540914-16540936 CTGGAGACTCAGAAGAGGAGAGG - Intergenic
1134926835 16:18171266-18171288 CTGGAGACTCAGAAGAGGAGAGG + Intergenic
1135253655 16:20922864-20922886 CTGGAGACCCAGAAGAAAGCTGG + Intronic
1135487841 16:22881451-22881473 CTGGAGACTGAGAGGAGATGAGG - Intronic
1135727858 16:24870838-24870860 CTAGAGATGCAGAAGAAAGATGG + Intronic
1135831061 16:25773802-25773824 CGGGAGACTCAGAAGAGAGGAGG - Intronic
1135985553 16:27181212-27181234 CTGGAGAGGCAGCAGAGAGCAGG + Intergenic
1136462676 16:30421476-30421498 CTGGACAGCCAGAAGACAGGCGG + Intronic
1136617941 16:31410199-31410221 GTGGAGAGTGAGAGGAGAGGGGG + Intronic
1137337395 16:47563814-47563836 CTGGAGGCTCAGAAGACTGGAGG - Intronic
1138057753 16:53853477-53853499 CTGGAGATTCAGAAGAGAGGAGG - Intronic
1138451508 16:57095844-57095866 CAGGAGATGCAGCAGTGAGGAGG - Intronic
1138719673 16:59064883-59064905 CTGGAGACTCAGAAGGGTGGGGG - Intergenic
1139316736 16:66078387-66078409 TTGCAGACTCAGAAGAGGGGAGG - Intergenic
1139399701 16:66671556-66671578 TTGGAGGTTCAGGGGAGAGGAGG - Intronic
1140901599 16:79372977-79372999 CTGGAGATGCTGTAGAGAGAAGG - Intergenic
1141310869 16:82912136-82912158 CTGGAGATTAAGGGGAGAAGAGG - Intronic
1143039135 17:4019663-4019685 CTGGAGGTTCAGAAGAGGTAAGG - Exonic
1143293124 17:5848113-5848135 CTGAAGACTCAGAAAGGAGGAGG - Intronic
1143968998 17:10778889-10778911 CTGAAGATACAGGAGAGAAGGGG + Intergenic
1144078770 17:11743410-11743432 CTGAGGAATTAGAAGAGAGGTGG - Intronic
1144329591 17:14212051-14212073 CCGGGGATTCAGGAGAGAGCGGG + Intergenic
1146016428 17:29237496-29237518 CTGGAGATAAAGAGGTGAGGTGG + Intergenic
1146204721 17:30892851-30892873 CTTAAGATTCAAAAGATAGGAGG - Intronic
1146614567 17:34344618-34344640 TTGGAGATTCAGAAGGGGGAAGG + Intergenic
1146623944 17:34421792-34421814 CTGGAGTTTGAGAAAAGTGGAGG + Intergenic
1146636365 17:34508465-34508487 CTGGAGATTCAGATGTGGGGAGG - Intergenic
1147595991 17:41717805-41717827 CCGGGGATACAGAAGGGAGGAGG - Intronic
1148120649 17:45208432-45208454 CAGGAGAATCAGCCGAGAGGCGG - Intergenic
1148784946 17:50141434-50141456 CTGGAGTTTCTGATGGGAGGAGG - Intronic
1149885439 17:60335216-60335238 CTTGAGATTCCGAAAAGTGGTGG + Intronic
1150319527 17:64200854-64200876 CTGGTGATTCTGAAAAGATGGGG - Intronic
1150665319 17:67130165-67130187 CTGGAGATTCAGAAGGTAGCGGG + Intronic
1151074598 17:71256530-71256552 CTGAAGGTACAAAAGAGAGGAGG + Intergenic
1152622534 17:81372480-81372502 ATGGAGCTTCAGGAGGGAGGAGG - Intergenic
1152891562 17:82884508-82884530 CTGAAGACGCAGAAGAGAGTGGG + Intronic
1153110346 18:1579036-1579058 ATGGAGACTCAGAAGAGAATTGG - Intergenic
1153350835 18:4079521-4079543 CTGGAGACTCAGAAGTGGGGAGG + Intronic
1153499597 18:5734651-5734673 CTGGAGACTCAGAAGGGTGGAGG + Intergenic
1153526176 18:5996936-5996958 TTGGGGATTTAAAAGAGAGGTGG + Intronic
1154055504 18:11009443-11009465 CTGGAGATTCAGCTGAAGGGAGG + Intronic
1154962507 18:21324008-21324030 TTGGAGATTCTGAAGGGAGAAGG + Intronic
1155771342 18:29704342-29704364 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1156185367 18:34656497-34656519 CTGGAAGTTCAGAAGGGAAGGGG - Intronic
1156422850 18:36974327-36974349 TTGGAGACTCAGAAGAGTGGAGG - Intronic
1156677081 18:39540536-39540558 TTGGAGGTTTAGAAGTGAGGAGG - Intergenic
1157615942 18:48987744-48987766 CTGGAGTTTAAGAAGACATGAGG + Intergenic
1157958155 18:52122171-52122193 TTGAAGATTGAGAAAAGAGGGGG - Intergenic
1158253357 18:55515894-55515916 CTGAAGAGTCAGGAGAGAAGAGG + Intronic
1158294312 18:55977936-55977958 TTGGAGATTCAGAAGGGAGGAGG + Intergenic
1158363352 18:56702084-56702106 CTGGGGAATCTGAAGAGAGCTGG + Intronic
1158554289 18:58462397-58462419 TTGGAGACTCAGAAGGAAGGTGG - Intergenic
1158606636 18:58901787-58901809 CTGGAGCTCCAGAGGAGATGGGG - Intronic
1158768151 18:60481096-60481118 TTGGAGACTCAGAAGGAAGGAGG - Intergenic
1158816423 18:61103169-61103191 CTGGAGACTCAGAAGCAGGGAGG + Intergenic
1158971666 18:62673958-62673980 CTGGAGATTGAGAATACTGGAGG - Intergenic
1159095734 18:63899411-63899433 CTGGAAATTCAGAAGAATGAAGG - Intronic
1159801301 18:72903244-72903266 TTGGAGAATCAGAAGAAGGGAGG - Intergenic
1161530176 19:4784106-4784128 GTGGAGACTCAGAAGCGGGGAGG + Intergenic
1163162716 19:15475151-15475173 GTGGAGATTCAGAAGGGTGAGGG + Intronic
1163191876 19:15682908-15682930 CTGTATTTTCAGTAGAGAGGGGG + Intronic
1163229300 19:15989310-15989332 CTGGAGACTCAGAAGAGGGAAGG - Intergenic
1164443850 19:28300544-28300566 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1164526315 19:29016056-29016078 AGGGAGAGACAGAAGAGAGGAGG - Intergenic
1164900594 19:31917941-31917963 CTGGAGATACAGGAGTGAGTTGG - Intergenic
1164901388 19:31928515-31928537 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1166008673 19:39925368-39925390 CTGGAGAATCAGAAAACATGGGG - Intronic
1166327770 19:42061788-42061810 CTGGAGAGTGACAAGAGGGGTGG - Intronic
1166917686 19:46206800-46206822 CTGCAGCTTCAGGAGAGGGGAGG + Intergenic
1167121705 19:47521160-47521182 CTGGAGAGGCCGAAGGGAGGAGG + Exonic
1167494128 19:49808206-49808228 CAGGAGATTCTGAAGCCAGGCGG + Intronic
1167691752 19:50989258-50989280 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1168156752 19:54477777-54477799 CAGGATATTGAGAGGAGAGGAGG + Intergenic
1168307719 19:55444521-55444543 AAGGTGATGCAGAAGAGAGGTGG + Intergenic
1168641997 19:58037019-58037041 CTGGAGACTCTGAAAAGAGAGGG - Intronic
925144334 2:1570779-1570801 CTGGAGACTCAGAGGCGGGGAGG - Intergenic
925216329 2:2098854-2098876 CTGGAGCTTCTAAAGATAGGTGG + Intronic
925476432 2:4221910-4221932 CTGGAGCTGGAGAAGAGAGATGG + Intergenic
925688203 2:6494367-6494389 CTGGTGAATCAGAACAGAGCTGG + Intergenic
925740233 2:6999291-6999313 TTGAAGATTCAGAAGGGAGGAGG + Intronic
926653077 2:15367736-15367758 GGGGAGATAAAGAAGAGAGGTGG + Intronic
926875845 2:17477730-17477752 TTGGAGACACAGAAGTGAGGAGG + Intergenic
926990082 2:18669671-18669693 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
928179326 2:29056872-29056894 CTCAAGAGTCAGAAGAGTGGAGG - Exonic
928320413 2:30278814-30278836 TTGAAGATACAGAAGAAAGGAGG - Intronic
928933156 2:36646104-36646126 GAGGAAAATCAGAAGAGAGGAGG - Intergenic
929123333 2:38501270-38501292 CTGTAGTTTCAGTAGAGACGGGG - Intergenic
929332346 2:40698005-40698027 CTGGATATTCAGCAAAGAAGAGG + Intergenic
929454959 2:42058974-42058996 ATGAACATTCAGAAGAAAGGAGG + Intergenic
930892919 2:56412005-56412027 CTGGAGACTCAGAAGGGTGAGGG + Intergenic
931162997 2:59714858-59714880 TTGTAGATTGAGAAGAGAAGAGG - Intergenic
931248945 2:60513576-60513598 GGGAAGATTCAGAAGAGAGAGGG - Intronic
931471275 2:62539944-62539966 CTGTAGAATGAGAAGAGGGGAGG + Intergenic
931914715 2:66941375-66941397 CGGGAGATGAAGAAGGGAGGAGG + Intergenic
932399508 2:71470192-71470214 CAGGAGATCAAGAAGAGAAGAGG - Intronic
932703302 2:74004976-74004998 CTGGAGATACAGAGGAGAGAGGG - Intronic
932875062 2:75442793-75442815 TTGGAGATTCAGAAGTGGGAAGG + Intergenic
933772370 2:85752735-85752757 CTGGAGATTCTGGAAAGAAGGGG - Intronic
934894039 2:98097253-98097275 TTGGAGACTCAGAAGTGGGGAGG - Intronic
935368714 2:102322113-102322135 CTGGAAATTCAGATAAGAGTTGG + Intronic
935476811 2:103532331-103532353 TTGGAGATTCAGAAGTGGGGAGG - Intergenic
936169669 2:110157641-110157663 CTGGATATGGAGGAGAGAGGAGG - Intronic
937355500 2:121195745-121195767 CTGGAGGGTCAGGAGAGGGGAGG + Intergenic
937511607 2:122601702-122601724 ATGGAGATTCAGAAACGAAGGGG + Intergenic
937527893 2:122793407-122793429 TTGATGCTTCAGAAGAGAGGAGG + Intergenic
938249021 2:129799351-129799373 CTGCAGTTTCAGGAAAGAGGAGG - Intergenic
938575638 2:132600947-132600969 CTGGAGATGCAGAGGAGGGAAGG - Intronic
938706951 2:133940129-133940151 CTGGAGATACAGAATTGAAGAGG - Intergenic
939027417 2:137030758-137030780 CTGGAGACTCAGAAATGGGGAGG + Intronic
939114314 2:138043023-138043045 CTGAAGTGTGAGAAGAGAGGAGG + Intergenic
939419542 2:141948123-141948145 TTGTATATTCAGTAGAGAGGGGG - Intronic
939943057 2:148375162-148375184 CTGAAGATTCAGCAGTTAGGAGG - Intronic
940210622 2:151253230-151253252 CTAGAGAATGGGAAGAGAGGAGG - Intronic
940750917 2:157626463-157626485 CTGCAGATCCAGATGAAAGGTGG + Intronic
941478886 2:165981826-165981848 CTGGAGATTCAGAAGTAGGGAGG - Intergenic
942538211 2:176988023-176988045 CAGGGGATGCAGAAGAGAGAAGG - Intergenic
943341359 2:186685736-186685758 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
943892780 2:193311396-193311418 CTTGAGATTGGGAAGAGAGGAGG + Intergenic
944634626 2:201663244-201663266 CAGGACATTCAGAAGATACGTGG + Intronic
945373916 2:209056534-209056556 TTGGAGATTCAGAAAAGGGGAGG + Intergenic
946150517 2:217764156-217764178 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
946372833 2:219290919-219290941 CTTGAGATGCAGCAGAAAGGGGG + Intronic
946600014 2:221349301-221349323 CTGTATTTTCAGTAGAGAGGGGG + Intergenic
946626025 2:221613138-221613160 CTGGAGACGCAGAGGAGAGAAGG + Intergenic
946716526 2:222559279-222559301 CTGGAGAGCCAGTAGAGATGGGG + Exonic
947526384 2:230878999-230879021 ATGGAATTTCAGAACAGAGGAGG - Exonic
948669853 2:239561306-239561328 CTGGAGACTCAGAAAGGAGGTGG - Intergenic
1168795695 20:609133-609155 CAGGAGACTGAGAAGAAAGGAGG - Intronic
1168800106 20:639268-639290 CTGTAGTTTTAGAAGAGACGGGG + Intergenic
1168962818 20:1880587-1880609 CTGGAGGTTCAGAGCAGGGGAGG + Intergenic
1169323214 20:4652615-4652637 ATGGAGACTCAGAAGTGGGGAGG - Intergenic
1169513731 20:6294267-6294289 CTGGAGACTCAGAAAGGGGGAGG - Intergenic
1169532415 20:6500008-6500030 CTGGAGCTTCTGAGGAGTGGTGG + Intergenic
1169730236 20:8778156-8778178 ATGGCAATTCAGAAGAGAGGTGG + Intronic
1169971481 20:11273384-11273406 CTGCAGATTAAGAAGAGAGTTGG + Intergenic
1169981675 20:11391722-11391744 CTAGAGTTTTGGAAGAGAGGGGG + Intergenic
1170048665 20:12115053-12115075 CTGAAGAGTCAGAAGTGTGGAGG + Intergenic
1170282066 20:14660705-14660727 CTGGGGATTCCAAAAAGAGGAGG - Intronic
1170335579 20:15267166-15267188 GTGGGGATGCAGAGGAGAGGGGG - Intronic
1170745758 20:19097644-19097666 GTGGAAAATCAGAAGAGAGAAGG - Intergenic
1170815186 20:19708074-19708096 AGGGAGAATCAGAAGAAAGGGGG + Intronic
1171374537 20:24683374-24683396 CTGGAGACTCAGAACGGTGGGGG + Intergenic
1171462823 20:25308602-25308624 CTGGAGTTTCAGGACAGAGTGGG + Intronic
1171805002 20:29669600-29669622 CAGGTGATTAAGAAGGGAGGGGG + Intergenic
1173314784 20:41933263-41933285 CTTGAGTTTCAGAAGAGATTTGG + Intergenic
1174029658 20:47612227-47612249 CTGGAGTTTGAAAAGAGAAGAGG + Intronic
1174785887 20:53432128-53432150 CTGGAGACTCAGAAGTGGGGAGG - Intronic
1175641417 20:60633608-60633630 CTGGGGAGTCAGAAGAGGAGGGG + Intergenic
1176745090 21:10644528-10644550 CTGGATTTTCAGTAGAGATGGGG + Intergenic
1178583353 21:33853985-33854007 CTGGGGATTCAGGACAGAAGAGG - Intronic
1178683983 21:34697110-34697132 TTAGAGATTCAGAAATGAGGAGG + Intronic
1178767163 21:35465339-35465361 CTTGAGAATCAGAACAGAGTAGG - Intronic
1179313248 21:40215640-40215662 TTGGAGACTCAGAAGTGGGGAGG + Intronic
1179318350 21:40267012-40267034 CGGGAGACTCAGAAGTGGGGAGG + Intronic
1179556676 21:42182988-42183010 CTGGAGGGTCAGGAGTGAGGTGG - Intergenic
1179833805 21:44014799-44014821 TTGGAGTCTCAGAAGAGAAGGGG + Intronic
1180678602 22:17606985-17607007 ATGGAGAATTAGAAGAGAAGCGG - Intronic
1180719021 22:17893165-17893187 CTGGGGATGAAGAAGGGAGGAGG - Intronic
1181410350 22:22713958-22713980 CAGAAGATTCAGAAGGGAGTGGG - Intergenic
1181731343 22:24849182-24849204 CTGGAGATACAGAAATGAAGAGG + Intronic
1182191370 22:28464161-28464183 CTAGAGACCCAGAAGAGATGGGG + Intronic
1183225496 22:36547075-36547097 CTGGAGACTGCAAAGAGAGGAGG + Intergenic
1184843113 22:47064042-47064064 CTGGAGATGCAGTTCAGAGGAGG - Intronic
1184984224 22:48118515-48118537 CTGGAAATTCAAGAAAGAGGGGG + Intergenic
1184998849 22:48229544-48229566 CTGGAGGTTCAGCTGAGAAGTGG - Intergenic
949277298 3:2299470-2299492 TTGAAGATTCAGAAGAAAGAGGG - Intronic
949862464 3:8518694-8518716 CTGGAGATAAAGATGAGAGCTGG + Intronic
950062370 3:10082642-10082664 CTGGGGATCAAGAAGAGTGGGGG - Intronic
950199374 3:11032291-11032313 CTGGAGACTCAGAAGGGTGGGGG - Intronic
950354264 3:12391358-12391380 CAAGAGTTCCAGAAGAGAGGTGG + Intronic
951277791 3:20710889-20710911 CTGGAGCTGAAGGAGAGAGGAGG + Intergenic
951491327 3:23272756-23272778 CTGGAGACTCAGGAGAGCTGTGG + Intronic
951514730 3:23545989-23546011 TTGGAGACTCAGAAGAGAGGAGG + Intronic
952199010 3:31106130-31106152 CTGGAGACTCAGAAGGGTGAAGG - Intergenic
952402315 3:32974583-32974605 CTGGAGATCCAGGAGAGCTGAGG + Intergenic
952493147 3:33891235-33891257 TTGGAGACTCAGAAGAGAGAGGG - Intergenic
952596524 3:35025565-35025587 CTGGAGAACCAGAAAAGAAGGGG + Intergenic
952637631 3:35551120-35551142 CCAGTCATTCAGAAGAGAGGGGG - Intergenic
952829801 3:37555015-37555037 GGGGAGATAGAGAAGAGAGGGGG + Intronic
953147809 3:40294925-40294947 CTGAAAATTCAAAAGAGAAGAGG + Intergenic
954164904 3:48748944-48748966 CTGGAGCTTAAGAAGAAAAGAGG + Exonic
955164951 3:56501765-56501787 CTGGAGTTTCGTTAGAGAGGAGG + Intergenic
955401900 3:58598186-58598208 CTGGGGATGGAAAAGAGAGGTGG - Intronic
955457561 3:59140617-59140639 CTGGAGACTCAGGAGTGGGGAGG + Intergenic
955821358 3:62899337-62899359 CTGGAAATTGCAAAGAGAGGTGG + Intergenic
955983153 3:64547212-64547234 CTGGAGGTTTCGAAGGGAGGAGG + Intronic
956377372 3:68629237-68629259 TTGGAGATTCAGAGGATGGGAGG - Intergenic
956630951 3:71316110-71316132 CTGGATCTGCAGAAGAGAAGGGG - Intronic
957936622 3:86951978-86952000 CTGGAGAAACAGATTAGAGGAGG + Intronic
958665176 3:97128014-97128036 CCGGAGACTCAGAAGTGGGGAGG - Intronic
959085018 3:101842860-101842882 TTAGAGATGGAGAAGAGAGGAGG + Intronic
959244363 3:103845718-103845740 TTAGAGATATAGAAGAGAGGAGG - Intergenic
960660077 3:120048307-120048329 CTGGAGTTTTGGAACAGAGGAGG - Intronic
960663801 3:120090784-120090806 ATTGAGATTCAGAAGAGATCTGG - Intronic
960855616 3:122099317-122099339 AGGGAGTTTCAGTAGAGAGGTGG + Intronic
961683683 3:128615733-128615755 CTGAAGATCCAGGAGAGAAGGGG - Intergenic
961994431 3:131226664-131226686 TTGGAGACTCAGAAGGGAGGAGG + Intronic
962330236 3:134471861-134471883 CTGGAGACTAAGATGACAGGTGG + Intergenic
962627237 3:137238075-137238097 CTGGGGATTCAGGGAAGAGGTGG + Intergenic
963106473 3:141651847-141651869 CTGGAGACTCAGAGAAGAGTGGG + Intergenic
964074805 3:152680761-152680783 CTGGAGAATAAGAAGATAGAAGG + Intergenic
966473712 3:180320918-180320940 CTGGATTTTCAGATGACAGGTGG + Intergenic
966809562 3:183831453-183831475 CTGGAGTTTCAGATGAGGGCTGG - Intronic
966958546 3:184909968-184909990 CTGGAGCTGCACAAGAGAGAGGG - Intronic
967358473 3:188601634-188601656 CTGGAAATTCAAAAGGGAAGGGG - Intronic
967500092 3:190187251-190187273 ATGGAAATTCAGAAGAGAACTGG - Intergenic
967912774 3:194555953-194555975 CAGGAGATGCAGAAATGAGGTGG + Intergenic
968492421 4:897196-897218 CTGCAGATTCACAGGAGAGCAGG + Intronic
969172441 4:5375111-5375133 CTGGAGTTTCAGAAGCCAGATGG - Intronic
969193820 4:5544905-5544927 CTGGAGAGACAGGAGTGAGGAGG - Intronic
969379484 4:6784114-6784136 AGGGAGATTCAGCGGAGAGGAGG + Intronic
970165722 4:13235849-13235871 TTGGAGACTCAGAAAAGGGGAGG + Intergenic
970558358 4:17258486-17258508 CTGGGAATTCAGAGGAGAGATGG - Intergenic
970949625 4:21738768-21738790 CTGGAAATTGAGAAGAAAGTGGG - Intronic
971265426 4:25092525-25092547 CTGGAGAATCAGAAGAGGTCGGG - Intergenic
972446038 4:39144713-39144735 CTGGAGACTCAGAAATGGGGAGG - Intergenic
972889456 4:43538363-43538385 CTGGAGATTCAGAAAGGGAGAGG + Intergenic
973192408 4:47400727-47400749 TTGGAGACTCAGAAGTGGGGAGG - Intronic
973695061 4:53482688-53482710 TTGGAGACTCAGAAAAGGGGAGG + Intronic
974032797 4:56790990-56791012 ATGGAGACTCAGAAGAGGGAGGG - Intergenic
974047200 4:56908120-56908142 CTGGAGTTTCGGGGGAGAGGTGG - Exonic
974126803 4:57706811-57706833 CTGCAAATTCAGGTGAGAGGGGG + Intergenic
974593844 4:63991133-63991155 CTGGAGATCCAGAGGAGGGAGGG + Intergenic
975126579 4:70789027-70789049 CTGGAGGATCAGATGGGAGGAGG - Intronic
975429609 4:74273285-74273307 CTGGACAGCCAGAAGAAAGGGGG + Intronic
975905354 4:79204716-79204738 CTGGAGACTCAGAAGGGGAGTGG - Intergenic
976277553 4:83292845-83292867 TTGGAGACTCAGAAGGGAAGAGG + Exonic
976563987 4:86532720-86532742 TTGGAGATTCAGAAAAGTGGAGG - Intronic
977472061 4:97453896-97453918 CTAGAGAAGTAGAAGAGAGGTGG + Intronic
977832436 4:101609401-101609423 CTGTATATTCAGTAGAGATGGGG + Intronic
977974549 4:103249023-103249045 CTGGAGACTCAGAAGCAGGGAGG - Intergenic
978278416 4:106979136-106979158 CAGGAAATTCAGAGGAGATGTGG + Intronic
979663850 4:123289172-123289194 CTGGAGATTCAGAACGGGGTAGG - Intronic
979664199 4:123293064-123293086 CTGGATATTCAGATCAGACGAGG + Intronic
979760787 4:124401229-124401251 TTGGAGACTCAGAATAGTGGGGG - Intergenic
980297880 4:130945725-130945747 CTAGATATTCAGAAGTGAGGAGG - Intergenic
981442782 4:144801849-144801871 TTGGAGATTCAGAAGAGGGGAGG - Intergenic
981889768 4:149721447-149721469 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
982188387 4:152826458-152826480 TTGGAGACTCAGAAGAGGGGAGG + Intronic
982335347 4:154230827-154230849 ATGGACATTCAGAAGACAGTGGG - Intergenic
982812293 4:159841056-159841078 TTGGAGGTTCAGAAAGGAGGAGG - Intergenic
985293519 4:188410243-188410265 CTGTAGATTCTAAAGAGAGAAGG + Intergenic
986539946 5:8834415-8834437 CTGGAGACTCAGAACAGGGAAGG + Intergenic
986986599 5:13507359-13507381 GTAGAGATAAAGAAGAGAGGAGG + Intergenic
987450372 5:18076496-18076518 ATGGAGATTCAGAAGAATTGGGG - Intergenic
987659226 5:20850924-20850946 CTAGAGACTCAGAAGCGAGGAGG + Intergenic
988764444 5:34355057-34355079 CTAGAGACTCAGAAGCGAGGAGG - Intergenic
988979029 5:36545905-36545927 TTGGAGACTCAGAAGTAAGGAGG + Intergenic
989392227 5:40912957-40912979 TTGGAGACTCAGAAGAGTTGGGG - Intronic
989407748 5:41080303-41080325 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
989515483 5:42337777-42337799 CTGGAGATGGAGATGACAGGTGG - Intergenic
990311853 5:54547928-54547950 CTGGAGAGTTTGAAGAGTGGTGG + Intergenic
991298526 5:65105259-65105281 ATGGAGAGTGAGAAAAGAGGAGG - Intergenic
991325173 5:65423154-65423176 CTGGAGATTCAGAAGGGGGAAGG + Intronic
992210853 5:74478305-74478327 CTGGACATTGAGAGGAGAAGAGG - Intergenic
992257914 5:74940560-74940582 CTGGAGACTTGGAAGAGTGGAGG + Intergenic
992276388 5:75124803-75124825 CTGGAGACTCAGAAGGGTAGGGG + Intronic
992551488 5:77864766-77864788 CTGGAGCTTGAGAGGACAGGGGG + Intronic
993204330 5:84861057-84861079 CTGGAGAAAAAAAAGAGAGGAGG - Intergenic
993369017 5:87069091-87069113 GTAGAGATTCAGTGGAGAGGTGG + Intergenic
995016186 5:107312262-107312284 CTGGCCACTCAGAAGTGAGGAGG - Intergenic
996147131 5:119990475-119990497 CCCGAAATCCAGAAGAGAGGGGG - Intergenic
996542987 5:124648993-124649015 CTGCAGAATAAGAACAGAGGGGG - Exonic
996945504 5:129062278-129062300 GTGGAGATGCTGAACAGAGGGGG + Intergenic
997089896 5:130844438-130844460 CTGGAGACTCAGAAGAGGGGAGG + Intergenic
998173597 5:139886629-139886651 CTTGAGAGGCAGCAGAGAGGTGG + Intronic
999057745 5:148598151-148598173 CAGGAGAGTCAGAAGAAATGAGG + Intronic
999372368 5:151063833-151063855 CTGGAGCCTCAGAAGCCAGGCGG - Intronic
999524117 5:152383846-152383868 CTGGAGACCCAGGAGAGATGAGG - Intergenic
999691999 5:154156127-154156149 CTGGAACTTCACAAAAGAGGAGG + Intronic
999923577 5:156350069-156350091 TTGGAGACTCAGAAGAGGAGAGG + Intronic
1000441347 5:161267432-161267454 TTGGAGACTCAGAAGTGAGGAGG + Intergenic
1000541273 5:162542869-162542891 CTGGATATTTAGAAGAGAAAGGG + Intergenic
1001033762 5:168281976-168281998 TTGGAGATGTAGAAGAAAGGAGG + Intergenic
1001480550 5:172086317-172086339 CTGGAAAGTGGGAAGAGAGGAGG + Intronic
1001652309 5:173324561-173324583 CTGGAGAGTCAAAAGAGAGGGGG - Intronic
1001751845 5:174137296-174137318 GTGGCAATTCAGAGGAGAGGTGG + Intronic
1002905736 6:1447590-1447612 CTGGAGACTCAGAAGGGGGGAGG - Intergenic
1003260736 6:4513221-4513243 CTGAAGATTCACCAGAGAGGAGG - Intergenic
1003290087 6:4772988-4773010 CTGGTGATTGGGAAAAGAGGAGG + Intronic
1004985277 6:21074974-21074996 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1005394866 6:25370920-25370942 TTGGTGACTCAGAAGAGGGGAGG - Intronic
1005513076 6:26529496-26529518 CTGGAGATACAGCAGTGAAGAGG + Intergenic
1006241288 6:32681328-32681350 TTGGAGACTCAGAAGAGGGGAGG - Intergenic
1006452248 6:34111960-34111982 CTGGAGATTCTGAAATGGGGAGG + Intronic
1006664343 6:35679758-35679780 CTAGAGACTCAGAAGAGGGCAGG + Intronic
1008501493 6:52187784-52187806 CTGGAGATTCCAAGGTGAGGTGG - Exonic
1009278340 6:61714881-61714903 ATGGAGACTCAGAAGAGTGGGGG + Intronic
1009402309 6:63271378-63271400 CTGGAGATACAGTAGAGATTGGG + Intergenic
1009709998 6:67305925-67305947 CTGGAGACTCAGAAAGGAGGAGG - Intergenic
1010803229 6:80202301-80202323 CTGAAGATGCAGGAGAGAGATGG - Intronic
1010977008 6:82326572-82326594 TTGGAGACTCAGAAGAAAGGAGG - Intergenic
1011066527 6:83332742-83332764 CTGGAGACTCAGATGGGAGGAGG + Intronic
1011886891 6:92107996-92108018 CTTGAGAATCAGAAGAGATTGGG - Intergenic
1012029560 6:94041066-94041088 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
1012351813 6:98260744-98260766 CTGGAGATTCAGAAGTGAGGAGG - Intergenic
1012700028 6:102444390-102444412 TTGGAGACTCACAAGGGAGGAGG - Intergenic
1012807685 6:103915784-103915806 CTGTATATTCAGAAGGGAGCTGG - Intergenic
1013380629 6:109566704-109566726 CTGGAGACTCAGAAGGGAGCAGG + Intronic
1013496156 6:110699563-110699585 TTGGAGATTCAGAAGAAGGGAGG + Intronic
1013508649 6:110824407-110824429 CTGGAGACTCAGAAAAGGGAGGG + Intronic
1014069661 6:117166891-117166913 CTGGAGACACAGAAGAGAGGTGG - Intergenic
1014366932 6:120555394-120555416 CTAGAGCTTCAGAAGTGAGGTGG + Intergenic
1015312726 6:131782958-131782980 CTGAAGCTTCAGAAGCCAGGTGG + Intergenic
1015916506 6:138222872-138222894 CTGGAGACTCAGAATGGGGGAGG - Intronic
1016689563 6:146921169-146921191 CTGGAAACTCAGAAGGGAGCGGG + Intergenic
1016927446 6:149365717-149365739 TTGGAGATTCAGAAGGAAAGGGG - Intronic
1017168942 6:151437741-151437763 CAGGAGATACAGAATGGAGGTGG - Intronic
1018718162 6:166551395-166551417 GTGGAGTTTCAGAAGACATGTGG + Intronic
1018949718 6:168371189-168371211 CTGGAAAGTCAGGAGAGATGAGG + Intergenic
1019098440 6:169607612-169607634 CTGGAGACTCAGAAGGGTAGAGG + Intronic
1019408152 7:894624-894646 CTGGAGAGTCAGAAGAGTCAGGG - Intronic
1019978215 7:4601483-4601505 CTGGAGACTCTGAAGGGTGGGGG + Intergenic
1021079196 7:16343346-16343368 CTTCAGATTCAGAAGAGTTGGGG - Intronic
1021321049 7:19211945-19211967 CTGGAGACTAGGAAGATAGGAGG - Intergenic
1021778001 7:24072730-24072752 CTGAAGAATTAGAAGAGATGTGG - Intergenic
1022123340 7:27331626-27331648 CTGGAGTTTCTGAAGAAAGAAGG - Intergenic
1022234672 7:28449499-28449521 GTGGAAATGTAGAAGAGAGGAGG - Intronic
1022354165 7:29596281-29596303 CTGAAGACTCAGAAGTGGGGAGG + Intergenic
1023080505 7:36522088-36522110 CAGGAGTGGCAGAAGAGAGGCGG - Exonic
1023114911 7:36853286-36853308 CTGGAGTGCCAGAAGAGAGAGGG + Intergenic
1023282620 7:38587046-38587068 CTAGAGATTCAGAATAGGTGTGG - Intronic
1023710715 7:42989578-42989600 CTGGAGATTCAAAACAGATTTGG - Intergenic
1026203627 7:68236554-68236576 CCTGAGATGCAGGAGAGAGGAGG + Intergenic
1026555475 7:71404989-71405011 CTGCAGATTCAGAAGAAAATGGG + Intronic
1026891002 7:73982429-73982451 GTGGGGAGTGAGAAGAGAGGAGG + Intergenic
1027166946 7:75841428-75841450 CTGGAGATCCAGGGAAGAGGTGG + Intergenic
1027854209 7:83488104-83488126 CTAGAGAGTGAGAAGAGGGGTGG + Intronic
1027855232 7:83502527-83502549 GTGAAGATCCAGATGAGAGGAGG - Intronic
1028926873 7:96367476-96367498 TTGAAGATTCAGAAGAGGAGAGG - Intergenic
1028967498 7:96818269-96818291 TTGGAGACTCAGAAGAGGGGTGG - Intergenic
1029538074 7:101167368-101167390 GTGGAGATTCCAAAGAAAGGAGG + Intergenic
1030145755 7:106353161-106353183 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
1030255151 7:107502170-107502192 TTGGAGATTCAGAAGAGGAAGGG - Intronic
1030963242 7:115953523-115953545 CTGCAGACACAGAAGAGAGAAGG + Intronic
1031003674 7:116447250-116447272 TTGGAGACTCAGAAGAGGGAGGG + Intronic
1031063891 7:117083346-117083368 CAGGAGAATCACCAGAGAGGCGG - Intronic
1031572739 7:123379130-123379152 CTGGGAATTAAGAAGAGAGATGG + Intergenic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1032543166 7:132721148-132721170 CTGGTGATTCAGAAGGAAGCAGG - Intronic
1033085449 7:138337214-138337236 CTGGGGAATGAGATGAGAGGAGG - Intergenic
1033203918 7:139400030-139400052 TTGGATATTCAGAAGACAAGAGG - Intronic
1034481247 7:151321551-151321573 CTTGAGTCTCAGCAGAGAGGAGG - Intergenic
1034481258 7:151321621-151321643 CTTGAGTCTCAGCAGAGAGGAGG - Intergenic
1035138666 7:156734479-156734501 ATGGAGAGTCAGAAGGGAGAGGG + Intronic
1035543755 8:462732-462754 TTGGAGACTCAGAAGAGGGAAGG + Intronic
1035981654 8:4379339-4379361 GAGGAGATTCAGGAGACAGGAGG + Intronic
1036576805 8:10035152-10035174 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1036986961 8:13543828-13543850 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1037005670 8:13776436-13776458 TTAGAGATTTAGAAGAGAGAGGG - Intergenic
1037250992 8:16894065-16894087 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
1037560024 8:20065381-20065403 CTGGAGATTCAGGAAAGAGTTGG + Intergenic
1037581960 8:20250689-20250711 CAGGAGAATCAGAGGGGAGGCGG - Intronic
1038932233 8:32206791-32206813 CTGGAGACTCAGAAGGGTGGAGG - Intronic
1039212200 8:35230297-35230319 CTGTAGATTTAGTAGAGATGGGG - Intergenic
1039442271 8:37603309-37603331 CTGGGGGTTCAGGAGAGAGAAGG - Intergenic
1039569091 8:38572805-38572827 CTGAAGATTCAGGAGAAATGTGG + Intergenic
1039836131 8:41257714-41257736 CTGGAGACTCAGAAGATCAGAGG - Intergenic
1039928546 8:41961372-41961394 CTGATGATGCAGAAGATAGGAGG - Intronic
1041357485 8:57015504-57015526 ATTGAGATTAAGGAGAGAGGAGG + Intergenic
1041724612 8:61006382-61006404 CTTGAGAGTAAGAAGAGATGAGG - Intergenic
1041893551 8:62898545-62898567 TTGGAGACTCAGAAGGGAGGAGG + Intronic
1041966059 8:63678443-63678465 CTGGGGAGTAAGAAGAGAGTTGG - Intergenic
1041971000 8:63742627-63742649 CTGTGTACTCAGAAGAGAGGAGG + Intergenic
1043074665 8:75683186-75683208 TTGGAGAGTCAGAAGCGGGGAGG - Intergenic
1044324487 8:90844303-90844325 CTGGAGGTTAAGAAGAAAGGAGG - Intronic
1044735301 8:95272502-95272524 CTGGAGACTCAGAAGAGAGGAGG - Intergenic
1044823599 8:96176225-96176247 CTGAATATTCAAAAGAGATGAGG - Intergenic
1045635691 8:104186222-104186244 ATGGAGATTCGGAAGAGTGAAGG + Intronic
1046777957 8:118183832-118183854 CTTGAGATTCAGAAGGCGGGAGG - Intergenic
1046927890 8:119812478-119812500 TTGGAGACTCAGAAGCGGGGAGG - Intronic
1047022640 8:120792333-120792355 TTGGAGACTCAGAAAAGGGGAGG + Intronic
1047607532 8:126489862-126489884 CTGCAGACTCAGAAGAGACTTGG - Intergenic
1047899866 8:129408413-129408435 CTGGAGATTCAGAAGGGTTGGGG - Intergenic
1047947317 8:129894565-129894587 CTGGAGGGTGAGAAGACAGGAGG + Intronic
1048101042 8:131351670-131351692 TTGGAGGTTGTGAAGAGAGGTGG - Intergenic
1048254944 8:132898549-132898571 CTGCAGGTTCAGAGGCGAGGCGG - Intronic
1048306696 8:133289592-133289614 CAGGAGAGTCAGAGGAGAGCTGG + Intronic
1048441405 8:134462170-134462192 CTGGTGATTCAGATGAGCAGTGG - Intergenic
1048504534 8:135008853-135008875 CTGGAGAATGAGAGGAGAGAGGG + Intergenic
1050495192 9:6233436-6233458 GAGGAGATACAGAAGAGAGGGGG - Intronic
1051528167 9:18070754-18070776 CTAGATAGACAGAAGAGAGGAGG + Intergenic
1051749455 9:20326104-20326126 ATGGAGATTCAGAAAAGCCGAGG - Intergenic
1052061726 9:23967732-23967754 CTGGAGACTCAGAGGATGGGAGG - Intergenic
1052256220 9:26459951-26459973 CTGGAGATAATGTAGAGAGGAGG + Intergenic
1052434766 9:28412097-28412119 CTGGAGAATCAGAAGAGGGGAGG - Intronic
1052565039 9:30138924-30138946 CTGGACATTCAGGAGAGGTGTGG - Intergenic
1052764315 9:32625298-32625320 CTGGAGTTCCAGGAGAGAAGGGG - Intergenic
1053487411 9:38470431-38470453 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1053524852 9:38818032-38818054 CTGGAGACTCAGAAGCGGGAGGG - Intergenic
1054197086 9:62042448-62042470 CTGGAGACTCAGAAGCGGGAGGG - Intergenic
1054641322 9:67546246-67546268 CTGGAGACTCAGAAGCGGGAGGG + Intergenic
1056455254 9:86753532-86753554 CAGGAAACTCAGAAGAGTGGGGG + Intergenic
1056974305 9:91236624-91236646 ATCGAGATTCAGAACAGAGCAGG + Intronic
1057977146 9:99618137-99618159 CTGGAGACTCAGAAGAGTAGGGG + Intergenic
1058070413 9:100595849-100595871 CTGTTGATTAAGAATAGAGGGGG + Intergenic
1058587462 9:106525602-106525624 CTGGAGACTCAGAAGGGGGTGGG + Intergenic
1058645894 9:107131254-107131276 CTGCAGATTCAAAAGACAAGTGG - Intergenic
1059418691 9:114177799-114177821 CTGCAGAATCAGAACAGAGAAGG - Intronic
1059642732 9:116233629-116233651 GTGGAGATGGAGAAGAGAAGAGG - Intronic
1059973528 9:119692108-119692130 CTGGGGACTCAGAAGAGGAGAGG - Intergenic
1061581137 9:131537011-131537033 TTGGTGTTTCAGAAGAGACGAGG - Intergenic
1062095827 9:134702726-134702748 CTGGACATTCAGCAGAGTGCTGG + Intronic
1186122544 X:6379589-6379611 CTGGAGACTCAGAAGTTGGGAGG - Intergenic
1186826308 X:13343548-13343570 TTGGAGACTCAGAAGGGAGGAGG - Intergenic
1187080287 X:15979042-15979064 CTGGAGACTCAGAAAGGGGGAGG + Intergenic
1187551766 X:20313123-20313145 TTGGAAACTCAGAAGAGGGGAGG - Intergenic
1188119579 X:26287467-26287489 CTGGGGATCCCGAAAAGAGGAGG - Intergenic
1188175241 X:26981297-26981319 GTAGAGATTCAGAAGAGTTGGGG + Intergenic
1189224715 X:39403122-39403144 CTGGAGTCTGAGCAGAGAGGTGG + Intergenic
1189237580 X:39499558-39499580 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1189496808 X:41516013-41516035 ATGGAGGGTCAGACGAGAGGTGG + Intronic
1189507582 X:41627561-41627583 CTAGAGACTCAGAATAGGGGAGG - Intronic
1190480830 X:50875118-50875140 GTGGGGATTTGGAAGAGAGGTGG + Intergenic
1190552638 X:51600294-51600316 CTGGAGGTGGAGAAGAGTGGAGG + Intergenic
1191178398 X:57531987-57532009 TTGGAGACTCAAAAGAAAGGAGG + Intergenic
1192016739 X:67339413-67339435 CTGGGGAAGCAGAAGAGAGAGGG + Intergenic
1192284389 X:69719505-69719527 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1192698500 X:73443790-73443812 CTGAAGATTAACCAGAGAGGTGG - Intergenic
1193065207 X:77252544-77252566 CTGGAAACTCAGAAGTGAAGAGG + Intergenic
1193222977 X:78948620-78948642 CTAGAGACTCAGAAGAGGGTGGG - Intronic
1194047497 X:89026546-89026568 TTGGAGACTCAGAAGAGAGGAGG - Intergenic
1194615312 X:96093651-96093673 TTGGAGACTCAGAAGGGAGGAGG + Intergenic
1194695109 X:97038013-97038035 CTGGAGACTCAGAAGGGGGTAGG - Intronic
1194874478 X:99169671-99169693 CTGGAGACTCAAAAGCAAGGAGG + Intergenic
1195031898 X:100934359-100934381 CTGGAAATTCAGAAAAGAGATGG + Intergenic
1196518468 X:116642164-116642186 GTGGAGATTCACAAGATAGAAGG + Intergenic
1198064209 X:133080258-133080280 CAGGAGAATCAGAAGAAAGAAGG + Intronic
1198105031 X:133453961-133453983 TTGGAGATGCAGAAGAGGGTAGG - Intergenic
1198267230 X:135021406-135021428 CTGCAAATTCAGAAGAGAAATGG + Exonic
1198417189 X:136432612-136432634 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1198594945 X:138226083-138226105 CTGGAGATACAGAGGTGAGTTGG + Intergenic
1198845904 X:140910187-140910209 CTGGAGATTCAGATGAGAGTTGG - Intergenic
1199319606 X:146422856-146422878 CTGGAGGTTCAGGAGAGGGAAGG - Intergenic
1199855219 X:151753984-151754006 CTGGAGATACAAGAGTGAGGAGG + Intergenic
1200353995 X:155528489-155528511 CTGGAGACTCAGAAGGGGAGAGG - Intronic
1200491400 Y:3827990-3828012 TTGGAGATTCAGAAGGGGGAAGG + Intergenic
1200794309 Y:7326496-7326518 CTGGAGACTCAGAAGTGGGGAGG + Intergenic