ID: 1138058598

View in Genome Browser
Species Human (GRCh38)
Location 16:53863372-53863394
Sequence GAGAGATTAGTATGGATTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 134}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138058598 Original CRISPR GAGAGATTAGTATGGATTCC TGG Intronic
903025846 1:20429463-20429485 GGGAGAATAGGATGGATCCCAGG - Intergenic
905965992 1:42095977-42095999 GAGAGATTAGCATGGATGAAAGG - Intergenic
906847856 1:49213814-49213836 GAGAGATCCCTATGGATTGCAGG - Intronic
908872278 1:68627002-68627024 GAAAGTCTAGTATAGATTCCAGG + Intergenic
917045541 1:170855859-170855881 GAGATATTAGTATGAACTCATGG + Intergenic
917827990 1:178843804-178843826 GTGAGATTATTGTGGACTCCTGG + Intronic
918279697 1:182992121-182992143 GAGATATAAGTATGAATCCCTGG + Intergenic
918626026 1:186656709-186656731 TAGTGATTGGTATGGATTCAGGG - Intergenic
918653205 1:186991435-186991457 GAGGTATTAGTATGAATTCACGG + Intergenic
918939089 1:190966628-190966650 GAGAGATTAGATTGGATTATTGG - Intergenic
920401986 1:205681686-205681708 GAGAGACTAGGGTGGAGTCCAGG + Intergenic
921991084 1:221368306-221368328 AAGAAATTAATATGGAATCCTGG - Intergenic
922981657 1:229832014-229832036 TATAGATTAGGAAGGATTCCAGG + Intergenic
1067482037 10:46607695-46607717 GAGAGATTAATGTGGAATTCAGG - Intergenic
1067612713 10:47734031-47734053 GAGAGATTAATGTGGAATTCAGG + Intergenic
1071628136 10:87194138-87194160 GAGAGATTAATGTGGAATTCAGG + Intergenic
1080388159 11:31822437-31822459 AAGAGATAAATAAGGATTCCAGG + Intronic
1083638906 11:64134949-64134971 GAGAGATTTGTGTGGGTTGCTGG + Intronic
1083988703 11:66233477-66233499 GAAAGAGAACTATGGATTCCAGG + Intronic
1084398836 11:68932004-68932026 GAGAGAGTAGGATGGTTTCGGGG + Intronic
1084398858 11:68932096-68932118 GAGAGAGTAGGATGGTTTCGGGG + Intronic
1084398869 11:68932143-68932165 GAGAGAGTAGAATGGTTTCGGGG + Intronic
1086859782 11:91911773-91911795 GAGAGAGTAGAATAGATTCAGGG - Intergenic
1092662411 12:10753181-10753203 GAGACATTAGTATGAATAACTGG - Intergenic
1095929912 12:47614728-47614750 TAGAGATTAGTATGGATAGAAGG - Intergenic
1096155818 12:49341035-49341057 GTGAGATTTGAATGGCTTCCGGG + Intergenic
1098779713 12:74671230-74671252 GAGCAATTGGAATGGATTCCAGG - Intergenic
1099079637 12:78160765-78160787 GAGAGAATATTATCCATTCCTGG + Intronic
1099763212 12:86946712-86946734 AAGAGAGTAGAATGGTTTCCAGG - Intergenic
1104228520 12:126860704-126860726 GGGAGATTATCCTGGATTCCAGG + Intergenic
1105026133 12:132850381-132850403 GAGTGAAGAGTTTGGATTCCTGG + Intronic
1110962534 13:81646858-81646880 AAGAGTTTAGTATGTAATCCTGG + Intergenic
1112159491 13:96853121-96853143 GAGAGAATGGTTTGGTTTCCTGG - Intergenic
1112524419 13:100130665-100130687 GATAGATTAGTTTAGTTTCCGGG + Intronic
1115008295 14:28512447-28512469 GAGACATTAGTATGAATTTATGG + Intergenic
1120363041 14:83530548-83530570 TAGAAGTTAGTATGGAGTCCAGG - Intergenic
1120549026 14:85846524-85846546 GAGAGCTTGGTATGGGATCCTGG - Intergenic
1124193045 15:27597223-27597245 GAGAGTTTAGTATGGCCCCCTGG - Intergenic
1124848389 15:33312465-33312487 GAGAGATGAGAATGGAGTCTGGG - Intronic
1127216252 15:56825571-56825593 GAAAAAGTAGTATGGAATCCTGG + Intronic
1138058598 16:53863372-53863394 GAGAGATTAGTATGGATTCCTGG + Intronic
1149725574 17:58890682-58890704 AAGAGATTAAAATGCATTCCAGG - Intronic
1150460847 17:65349391-65349413 GAGAGATGAGCCTGGATTTCAGG + Intergenic
1150588115 17:66536781-66536803 GACAGATTCCTGTGGATTCCTGG + Intronic
1155722431 18:29033446-29033468 TAGAGATAATTATGTATTCCAGG - Intergenic
1155816704 18:30320458-30320480 AAGAGATTAGGCTGGATTTCTGG - Intergenic
1157139681 18:45093279-45093301 AAGAGGTTAATATGGATTTCAGG + Intergenic
1165321914 19:35090798-35090820 GAGAGATGGGTACGGAGTCCTGG + Intergenic
1167673335 19:50869112-50869134 GAGAGATTATGATGGGCTCCTGG - Intronic
927500242 2:23577768-23577790 GAAAGATCAGTAGGGCTTCCTGG + Intronic
929484247 2:42340300-42340322 GAGAGAAAAGAATGGATCCCAGG - Intronic
929899240 2:45986964-45986986 GAAAGATTAGTGTGGTTGCCGGG + Intronic
930694658 2:54399216-54399238 GAGAGATTACTAAGAATCCCAGG + Intergenic
932434255 2:71693998-71694020 GAGAGAGTTGCAGGGATTCCTGG + Intergenic
936084831 2:109460258-109460280 GAGTGAATAGTATCCATTCCAGG + Intronic
937692851 2:124775927-124775949 GAGATCTGAGTATGCATTCCTGG + Intronic
942572812 2:177330544-177330566 GTGAGCTGAGTATTGATTCCAGG + Intronic
945627496 2:212229048-212229070 GACATATCAGTATGGATTCATGG + Intronic
946066107 2:216988544-216988566 GAGAGATGGGAATGGATTCTGGG + Intergenic
947503760 2:230691251-230691273 GAGGGTTGAGTTTGGATTCCTGG - Intergenic
1169867152 20:10214412-10214434 GAGGGATGAGTATGAATTACTGG - Intergenic
1169883998 20:10377427-10377449 GAGAGCTGAGAATGGAATCCAGG - Intergenic
1170024422 20:11873393-11873415 GAGAGATGAGTTAAGATTCCAGG - Intergenic
1171952712 20:31435629-31435651 GAGTGATGTGTATGGCTTCCTGG - Intergenic
1172995173 20:39064995-39065017 GGGAGATTAGTTTGGGTTCTGGG + Intergenic
1173905788 20:46627798-46627820 GACAGATTAGTAGGGATCACCGG + Intronic
1175137894 20:56838884-56838906 GAGAGATGAAGAAGGATTCCAGG + Intergenic
1177233383 21:18352265-18352287 GAGATATTAGAATTGATGCCAGG - Intronic
1178700258 21:34827471-34827493 AAGAGATTAGTATGAATGCGAGG + Intronic
1178984426 21:37290753-37290775 GAGAGATGTGTATGGATATCAGG + Intergenic
1185036505 22:48480004-48480026 GTGAAATTAGTATGGATTCTTGG - Intergenic
957172487 3:76756442-76756464 GTGAGATTAGCATGGATTTGGGG + Intronic
959112816 3:102142557-102142579 GAGTGATTACTGTGGACTCCTGG + Intronic
961718279 3:128873901-128873923 GAGTGTTTAGTCTGGATTCCTGG + Intergenic
961804956 3:129482641-129482663 GAGAGAGTAGAATGGTTTCGGGG + Intronic
963383729 3:144564062-144564084 GAGAGATTAGTGTCAATTCTAGG + Intergenic
963513607 3:146279678-146279700 CAGAGATTAGAATGGTTGCCAGG + Intergenic
963555052 3:146776653-146776675 GAAACATAAGTAAGGATTCCAGG + Intergenic
966455103 3:180105858-180105880 GGAAGAATAGTATGGATTCTGGG + Intergenic
966607538 3:181836329-181836351 CTGAGATCAGTCTGGATTCCAGG - Intergenic
966823856 3:183947118-183947140 GAGAGGTAAGTGTGGAATCCAGG - Intronic
967762674 3:193242558-193242580 TAGAGATTAATAAGGATGCCAGG + Intronic
968879468 4:3291927-3291949 GTGTGATTAGTTTGGATCCCAGG - Intergenic
972210885 4:36835701-36835723 GAGAGATGAGTACAGATCCCAGG - Intergenic
972314978 4:37917659-37917681 GAGAGTTTGGGATGGATGCCGGG + Intronic
972907512 4:43768725-43768747 AAGAGATTACTATGGATACGAGG - Intergenic
974610350 4:64208471-64208493 GTGAGATTAGTATGGCTATCAGG + Intergenic
975031132 4:69618341-69618363 GATTGATTAGTATGAGTTCCTGG - Intronic
976205282 4:82618322-82618344 GAGTGACAAGTTTGGATTCCAGG + Intergenic
976954351 4:90877093-90877115 GAGAAACTAGTATTGTTTCCAGG + Intronic
977263265 4:94823568-94823590 GAGGGCTTAGTATGCAATCCTGG - Intronic
977894713 4:102350066-102350088 GAGAGATCAGTATCAATTCATGG + Intronic
981748609 4:148073168-148073190 GAGAGATTAGCAGGGAGGCCTGG - Intergenic
982138173 4:152292599-152292621 CAGAGATTAGAATGGAGTCCCGG - Intergenic
984326178 4:178254290-178254312 GAAAGATTAATATGGCTTTCAGG - Intergenic
985192539 4:187391540-187391562 GAGAGATTATTCTGGATTTTTGG - Intergenic
987951382 5:24681455-24681477 GATAGATTAGTATGCATGCTTGG + Intergenic
988835751 5:35030624-35030646 GAGAGATGACCATGGATTTCTGG + Intronic
990059880 5:51634606-51634628 AAGAGATGAGTATGGCTTTCTGG - Intergenic
990607917 5:57428874-57428896 GAGAAATCAGAATGGCTTCCGGG + Intergenic
1000947057 5:167435924-167435946 GAGAGATGAGTCAGGATACCTGG + Intronic
1001334264 5:170784487-170784509 GAGACATTAGGCTGGATTTCTGG + Intronic
1003682312 6:8268245-8268267 GAGGAATTAGCATGGGTTCCAGG + Intergenic
1005192376 6:23240166-23240188 CAGAGAGTAGAATGGTTTCCAGG - Intergenic
1005765949 6:29012252-29012274 TAGGGATTTGTATGTATTCCAGG + Intergenic
1008621169 6:53272822-53272844 TGGAGAGTAGTATGGAGTCCAGG - Intronic
1010065649 6:71679899-71679921 GAGAGGTTATTCTGGATTCATGG + Intergenic
1017698692 6:157045976-157045998 AAGAGCTCAATATGGATTCCTGG - Intronic
1018560422 6:165096691-165096713 GAGTGAGTAGTGTGGCTTCCAGG + Intergenic
1022374042 7:29796923-29796945 GAAAGATTATTATGGCTTCAGGG + Intergenic
1022723511 7:32961157-32961179 GGGAGGTTAGGATGGAATCCTGG + Intronic
1023088730 7:36598171-36598193 GAGATATCAGCAAGGATTCCAGG - Intronic
1023284226 7:38602609-38602631 GGGAGATTATTCTGGATTACTGG - Intronic
1024041103 7:45555540-45555562 CAGAGAGTAGAATGGTTTCCAGG + Intergenic
1025050120 7:55726760-55726782 GGGAGGTTAGGATGGAATCCTGG - Intergenic
1031146444 7:118002308-118002330 GAGAGTTGAGTGTGGAATCCCGG - Intergenic
1031691431 7:124792873-124792895 GAGAGAAGAGTAGAGATTCCTGG - Intergenic
1032082215 7:128865347-128865369 GAGAGATGAGAAGGGAGTCCAGG - Intronic
1033565034 7:142570037-142570059 CTGAGATAAGTATGAATTCCTGG + Intergenic
1036520154 8:9484229-9484251 GAGAGAATGGTGTGGATTTCTGG + Intergenic
1037532578 8:19791946-19791968 GAGAGATCAGTGTGAATTCATGG + Intergenic
1039096056 8:33887262-33887284 GAGAGATGACTTTTGATTCCAGG - Intergenic
1043329503 8:79097638-79097660 GAGAAATTATTATGGATTCTGGG + Intergenic
1043927297 8:86051636-86051658 GATAGATTTGTCTGGATTCAGGG - Intronic
1047806614 8:128367650-128367672 GAGAGTTTAGAAAGGCTTCCTGG + Intergenic
1048733102 8:137465977-137465999 GAGAGATTAGAAGGAATACCAGG - Intergenic
1050043079 9:1515750-1515772 GCAAGATTTGTATTGATTCCTGG - Intergenic
1058043083 9:100325899-100325921 GAGAGATTACAAGTGATTCCTGG + Intronic
1061149921 9:128822815-128822837 GGGAGATGAGGATGGCTTCCTGG + Exonic
1185652465 X:1658321-1658343 GAAAGATTAGTTTGTACTCCGGG + Intergenic
1189117433 X:38357617-38357639 GAGAGACTTGGATGTATTCCTGG - Intronic
1189666277 X:43358050-43358072 TGGAGATTAGTATGGATTGAAGG - Intergenic
1190269745 X:48853347-48853369 GAGAGATTATTTAGGATACCTGG - Intergenic
1190906023 X:54729246-54729268 GAGAGATTTGTGTGTATACCAGG - Intergenic
1193968812 X:88024752-88024774 GAGAGATCAGTATGAACTCATGG + Intergenic
1195865462 X:109427919-109427941 GAGAGTTTAGTATGAATTTATGG + Intronic
1199083639 X:143605406-143605428 GAGAGATGATTATGGGTTTCTGG + Intergenic
1199760909 X:150903383-150903405 GAGAGAGGAGTTTGGATTCCTGG + Intergenic
1201483683 Y:14469180-14469202 GATAGCTGAGTATGGCTTCCAGG + Intergenic
1201485173 Y:14486447-14486469 GAGAGATTAGGTGAGATTCCAGG + Intergenic