ID: 1138063600

View in Genome Browser
Species Human (GRCh38)
Location 16:53917112-53917134
Sequence ATGGGGTAGCAGAGTAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 307}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138063600_1138063608 14 Left 1138063600 16:53917112-53917134 CCATCCTTACTCTGCTACCCCAT 0: 1
1: 0
2: 1
3: 25
4: 307
Right 1138063608 16:53917149-53917171 CTCATTGAACACTCCAAGCCTGG 0: 1
1: 0
2: 0
3: 26
4: 128
1138063600_1138063610 28 Left 1138063600 16:53917112-53917134 CCATCCTTACTCTGCTACCCCAT 0: 1
1: 0
2: 1
3: 25
4: 307
Right 1138063610 16:53917163-53917185 CAAGCCTGGATTCCTTCACTTGG 0: 1
1: 0
2: 1
3: 17
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138063600 Original CRISPR ATGGGGTAGCAGAGTAAGGA TGG (reversed) Intronic
900500238 1:3000908-3000930 ATGGTGAAGCAGAGTAGGGGAGG + Intergenic
901077053 1:6561736-6561758 TTGGGATTGGAGAGTAAGGATGG + Intronic
901510921 1:9717692-9717714 GAGGGGTAGCAGAGGAAGGAGGG + Intronic
902919929 1:19659620-19659642 AAGGGGAAGAAGAGAAAGGAAGG + Intergenic
903344980 1:22678114-22678136 TTGGTTTGGCAGAGTAAGGAAGG + Intergenic
904238224 1:29127575-29127597 CTGGGGTGGCAGAGGAGGGAAGG + Intergenic
904905771 1:33896226-33896248 AGGGGGTAGGAGGGTAAGGAGGG + Intronic
905274508 1:36808234-36808256 ACAGCGTAGCAGAGTAAGAAAGG - Intronic
907203382 1:52747455-52747477 ATGGTGTAGCAGAAAAAGTATGG + Intronic
910050645 1:82970069-82970091 ATGGGGTGGCAGAGTCAAGGAGG + Intergenic
910462722 1:87466138-87466160 ATGACGGAGCAGAGTATGGAAGG + Intergenic
910476976 1:87617679-87617701 ATGGGGGAGCAAAGCAAGCAAGG + Intergenic
911117497 1:94260990-94261012 ATGGGGGTGCAGAATTAGGAAGG - Intronic
913647545 1:120873371-120873393 ATTGGCTAGCATTGTAAGGATGG + Intergenic
914079094 1:144389489-144389511 ATTGGCTAGCATTGTAAGGATGG - Intergenic
914100085 1:144577013-144577035 ATTGGCTAGCATTGTAAGGATGG + Intergenic
914173998 1:145258036-145258058 ATTGGCTAGCATTGTAAGGATGG - Intergenic
914298904 1:146360669-146360691 ATTGGCTAGCATTGTAAGGATGG - Intergenic
914528659 1:148499221-148499243 ATTGGCTAGCATTGTAAGGATGG - Intergenic
914637734 1:149567887-149567909 ATTGGCTAGCATTGTAAGGATGG + Intergenic
915939035 1:160106746-160106768 ATTGGACATCAGAGTAAGGAAGG - Intergenic
919824555 1:201494178-201494200 AGGGGGTGGCATAGGAAGGAAGG - Intronic
919993720 1:202728585-202728607 ATGTGGTAACAGAGTAAACAAGG + Exonic
920657337 1:207886767-207886789 ATGGGGGTGCAGAGCAAGGAAGG + Exonic
923293285 1:232568241-232568263 ATGAAGCAGCAGAGAAAGGAAGG + Intergenic
923937103 1:238775019-238775041 ATTGGGTAACAGAGTAATGCTGG + Intergenic
924878723 1:248134728-248134750 ATGTTGAAGCATAGTAAGGAAGG + Intergenic
1063507054 10:6609137-6609159 CTGAGGTAGCAGAGAAAGGAGGG + Intergenic
1063797723 10:9531982-9532004 ATTAAGTGGCAGAGTAAGGAAGG + Intergenic
1065044979 10:21739090-21739112 GTGGGGTGTCAGAGTGAGGATGG - Intronic
1065748144 10:28860657-28860679 AGTGGGTAGCAGGGAAAGGATGG + Intronic
1066523815 10:36253385-36253407 ATGGGGAAGTAGTGTCAGGAAGG - Intergenic
1066761417 10:38757077-38757099 TTGGGGTAGTAGAAAAAGGAAGG + Intergenic
1067307380 10:45077053-45077075 TTGGGGGAGCACAGGAAGGAAGG + Intergenic
1067833364 10:49622850-49622872 AGGTGGTGGCAGAGCAAGGAGGG + Intronic
1069078778 10:64065909-64065931 AGGGGGGGGCAGGGTAAGGAGGG + Intergenic
1069410003 10:68143598-68143620 ATGGGGTGGAAGTGGAAGGAGGG + Intronic
1070227325 10:74523375-74523397 ATGGGGAAGTAGAGAAAGAAAGG - Intronic
1070276064 10:75008147-75008169 ATGGTGATGCAGAGTGAGGATGG + Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1071221090 10:83464984-83465006 TTGGGATTGTAGAGTAAGGATGG - Intergenic
1071270643 10:84003817-84003839 ATGGGGAAGGTGAGGAAGGAGGG - Intergenic
1072388247 10:94955063-94955085 GTGGGGTGGCAGAGTGGGGAGGG - Intronic
1073050190 10:100662107-100662129 AAGGGGTAGCAGTGTAGAGAGGG + Intergenic
1073324043 10:102632293-102632315 CTGGGGGAGCAGGGTAAGGCAGG + Exonic
1073821911 10:107273840-107273862 ATGTGGTAGCAGAAAAAGCAAGG + Intergenic
1074249873 10:111734282-111734304 ATGGCGTGGCAGAGAAAAGAAGG - Intergenic
1074438623 10:113455622-113455644 ATGGGGAAACAGACTCAGGATGG - Intergenic
1074541635 10:114370040-114370062 ATGGGGAAACAGAGTCAGGGAGG - Intronic
1075384462 10:122045329-122045351 ATGGCGAAGCAGCGTAAGGCAGG + Intronic
1075643483 10:124082210-124082232 CTGGGGCAGCAGATTAAGGTGGG - Intronic
1079260619 11:18875880-18875902 ATGTGGTTGCAGAGGAAGAATGG + Intergenic
1079464519 11:20716188-20716210 ATGGGCTAGCAGAGCAGGCATGG + Intronic
1084470403 11:69356138-69356160 ATGGGATGGGAGAGAAAGGAAGG + Intronic
1084617491 11:70246245-70246267 ATGGGGCAGCTGAGCCAGGAAGG - Intergenic
1085907517 11:80782288-80782310 GTGGGGTAGCAGAGGAAAGGTGG + Intergenic
1088971798 11:114780443-114780465 ATGTGGTAGAAGAGTTAGGAAGG + Intergenic
1090252246 11:125259833-125259855 GTGGGATGGCAGAGTTAGGATGG - Intronic
1091031253 11:132190289-132190311 GTGAGGTAGCATAGCAAGGAAGG + Intronic
1091661005 12:2383559-2383581 ATGAGACAGCAGAGTAAGTAGGG + Intronic
1092782732 12:12002208-12002230 ATAAGGTAGCAGAGTAAACATGG + Intergenic
1093203730 12:16221710-16221732 ATGGGGCAGGAGAGGAAGCAGGG + Intronic
1094218705 12:27971116-27971138 GTAGGGTATCAGAGAAAGGATGG - Intronic
1094423674 12:30297652-30297674 ATGGGGAAGAAGAGAAAGAAGGG - Intergenic
1095313561 12:40729954-40729976 TTGGGGGAGTAGAGAAAGGAAGG + Intronic
1095724245 12:45434567-45434589 CTGGGATAGAAGAGGAAGGAGGG + Intronic
1096583369 12:52602648-52602670 CTGGGGGAGCAGAGGAGGGAAGG - Intergenic
1097119652 12:56721370-56721392 GTGGGGCAGGAGAGCAAGGAGGG + Exonic
1097279273 12:57834529-57834551 ATGGGGCAGAGGAGGAAGGAGGG + Intronic
1097507498 12:60494290-60494312 ATGGAGAAGCAGAGGAAGCAGGG + Intergenic
1100418582 12:94405840-94405862 ACAGGGTAGCAGAGAAAAGAGGG + Intronic
1100665890 12:96752703-96752725 ATTGTGTAGCAGAGAAAGCACGG - Intronic
1101376078 12:104172482-104172504 ATGGAGTGGAAGAGTAAGGAAGG + Intergenic
1101580237 12:106036305-106036327 ATGGGGTGGGAGAGAAAGGAGGG + Intergenic
1101952423 12:109187085-109187107 AAGGGGTAGGAAAGGAAGGAGGG + Intronic
1102019220 12:109670182-109670204 GCTGGGTAGCAGAGTAGGGAGGG - Intergenic
1102957007 12:117065291-117065313 CTGGGGGAGCAGAGGAAGAAGGG + Intronic
1104579189 12:129997297-129997319 CAGAGGTAGCAGAGGAAGGAAGG + Intergenic
1104604125 12:130175510-130175532 ATGGGGAAGCAAAGGAAGGCCGG + Intergenic
1104610086 12:130220540-130220562 AGGAGGTAGCAGAATAAGAAAGG - Intergenic
1105320965 13:19321832-19321854 ATGAGGTAGCAAAGAATGGATGG - Intergenic
1106505014 13:30363677-30363699 ATGGTGTAGGAGAAAAAGGATGG - Intergenic
1106973328 13:35173164-35173186 AGAGGGTAACAGAATAAGGAAGG + Intronic
1108360783 13:49666333-49666355 ATGTGGAAGCAGAGTGGGGAGGG + Intronic
1110080267 13:71300741-71300763 ATGGGATAGCAGAGAGAAGAAGG - Intergenic
1115530559 14:34323051-34323073 ATGGGGCAGGAGAGGAAGAAAGG + Intronic
1116321366 14:43468796-43468818 ATAGGGTAGCATAATAAGAAAGG + Intergenic
1116627417 14:47283135-47283157 TTGTGGTAACAGAGAAAGGAAGG + Intronic
1117000194 14:51364195-51364217 ATGGGTTAACAGAGAAGGGAAGG + Intergenic
1119621745 14:76136799-76136821 AGGGGGAAGGAGAGGAAGGAAGG - Intergenic
1122877048 14:104672428-104672450 TTTGGGAAGCAGAGGAAGGAGGG + Intergenic
1125229536 15:37437311-37437333 AGGGGCTAGGAGTGTAAGGAAGG - Intergenic
1128871258 15:71156951-71156973 ATGATGCAGCAGAGTAAGCAGGG - Intronic
1128935634 15:71744110-71744132 AGGTGGCAGCAGAGAAAGGAAGG + Intronic
1131052887 15:89359882-89359904 AGGGGGTAGCACAGCAGGGAGGG - Intergenic
1131329676 15:91485412-91485434 ATGAGGAAGCAGAGTGAGAAAGG + Intergenic
1131970067 15:97882809-97882831 AGGGGGTACCAGAGAAACGAAGG - Intergenic
1132855897 16:2044403-2044425 GCGGGGAAGCAGAGGAAGGAAGG + Intronic
1132982008 16:2743016-2743038 ATGGGGTGGCTGTGTTAGGAGGG + Intergenic
1134031625 16:10996626-10996648 ATGGGGCCGCAGAGGAAGGGAGG - Intronic
1134038103 16:11047463-11047485 ATGGGGAAGCAGATTTAGAATGG + Intronic
1135608173 16:23840744-23840766 ATGGGTTGGGAGAGGAAGGATGG + Intronic
1136080411 16:27848882-27848904 ATGCTGTAGCAGAGTGAGCAAGG + Intronic
1138017386 16:53441754-53441776 TTGGGGTAGAAGGGTAAGGATGG + Intronic
1138063600 16:53917112-53917134 ATGGGGTAGCAGAGTAAGGATGG - Intronic
1139127178 16:64092332-64092354 ATGGGATTTCAGAGCAAGGAAGG + Intergenic
1139361448 16:66402471-66402493 ATGGGGTTGCAGGGGAAGGGGGG + Intronic
1139361461 16:66402502-66402524 ATGGGGTTGCAGGGGAAGGGGGG + Intronic
1140016570 16:71192571-71192593 ATGGGGTGGGAGAGCAAGAAAGG - Intronic
1140634790 16:76899173-76899195 ATAGGGTAGCAGAATAGAGAAGG + Intergenic
1141187792 16:81800360-81800382 GTTGGGGAGCAGGGTAAGGATGG - Intronic
1142759571 17:2034852-2034874 ATGGGGCAGCAGGGGAGGGAGGG - Intronic
1143202438 17:5122144-5122166 GTGGGGTGGCAGGGGAAGGAAGG + Intronic
1144021731 17:11244133-11244155 TTGGGGAAGCAGAGTAACCACGG + Intronic
1144262610 17:13537405-13537427 ATGGAGGAGCTGAGAAAGGAAGG - Intronic
1146164072 17:30574636-30574658 GTGGGGCAGCAGGGGAAGGAAGG - Intergenic
1146952839 17:36918754-36918776 ATGGGGGTGCACAGGAAGGAAGG - Intergenic
1150724731 17:67642433-67642455 AGGGGGTAGCAGAAGAGGGAAGG - Intronic
1152562453 17:81085372-81085394 ATGGGACAGCAGAGGAAGGAGGG + Intronic
1154515542 18:15161107-15161129 ATGAGGTAGCAGAGAAAGAAAGG + Intergenic
1155465827 18:26134116-26134138 CTGGGGCAGCAGGGTAACGATGG - Intronic
1156697485 18:39784378-39784400 ATGGGGTAGGAGAGTGGAGATGG - Intergenic
1158450681 18:57561732-57561754 ATGTGGTAGCAGGGAATGGAGGG - Intronic
1158794508 18:60827019-60827041 TTGGGGTAGCAGAGTGGAGAGGG + Intergenic
1158813740 18:61069315-61069337 ATGCAGAAGCAGAGTATGGAAGG - Intergenic
1159543743 18:69814086-69814108 CTCTGGTAGCAGAGTAGGGATGG + Intronic
1161630405 19:5352116-5352138 ATGGGCTGGAAGAGTCAGGAGGG - Intergenic
1163818068 19:19479762-19479784 ATGGTGGAGCAGGGGAAGGAGGG - Intronic
1164864715 19:31595182-31595204 ATGGAGTTGCAGAGCAGGGAAGG + Intergenic
1165159889 19:33809952-33809974 ATGGGGCAGGAGAGGCAGGATGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166147399 19:40847052-40847074 CTGGGGTTGCAGAGAGAGGATGG + Intronic
1166151548 19:40878937-40878959 CTGGGGTTGCAGAGAGAGGATGG + Intronic
1166170420 19:41024441-41024463 CTGGGGTTGCAGAGAGAGGATGG + Intergenic
1166178639 19:41091709-41091731 CTGGGGTTGCAGAGAGAGGATGG - Intronic
1167128515 19:47568652-47568674 TTGGAGTAGGAAAGTAAGGAAGG - Intergenic
1167501423 19:49850930-49850952 ATGGGGTGGCAGAAGAACGAAGG - Intronic
925439917 2:3876599-3876621 AGGGGGTGGTAGAGTCAGGATGG + Intergenic
927205650 2:20608723-20608745 TTGGGGCAGCAGAGTGAGCAAGG - Intronic
927257477 2:21052580-21052602 GTGGGGATGCGGAGTAAGGATGG + Intergenic
929834478 2:45382489-45382511 ATGGGGTAACAGAGGGAGGAAGG - Intergenic
929836549 2:45406229-45406251 ATGGAGGAGCAGTGTAGGGAAGG + Intronic
931072246 2:58665907-58665929 AATGGATAGCAGAGTAAAGAAGG + Intergenic
931597695 2:63967766-63967788 AAGGGGTAGCAGAGGGATGAGGG + Intronic
933988077 2:87610207-87610229 TTTGGGTATCAGAGTAATGACGG - Intergenic
934163865 2:89276462-89276484 ATGGGGTGGCATAGAAAGTAGGG - Intergenic
934203407 2:89906062-89906084 ATGGGGTGGCATAGAAAGTAGGG + Intergenic
934614256 2:95761538-95761560 ATGGGGTCCCAGAGCAGGGAAGG - Intergenic
936305764 2:111340601-111340623 TTTGGGTATCAGAGTAATGACGG + Intergenic
937268178 2:120630287-120630309 AGGGGGTGGCAGAGTGGGGAGGG + Intergenic
938124947 2:128664693-128664715 CTGGGGTAGCAGTGGGAGGAGGG + Intergenic
938758405 2:134401397-134401419 ATGATGTAGCAGACTCAGGAAGG - Intronic
939658662 2:144859831-144859853 TTGGGGTAGCAATGTAAGGAAGG - Intergenic
940074501 2:149726065-149726087 ATGGTGTAGCAGAAAAAGAAGGG + Intergenic
941327478 2:164134799-164134821 AAGAGGGAGCAGGGTAAGGAAGG + Intergenic
942612366 2:177755544-177755566 ATGGGGTCGCAGCAGAAGGAGGG - Intronic
942679166 2:178458793-178458815 ATGGGGAAGCAGCGAACGGAGGG - Intronic
944293796 2:198039122-198039144 AGGATGTAGCAGACTAAGGAAGG + Intronic
944586976 2:201181141-201181163 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
946179712 2:217942152-217942174 ATGGGGAAGCAGAGCCAGAAGGG + Intronic
946199599 2:218064195-218064217 ATGGGGAAGCAGAGCCAGAAGGG + Intronic
946691618 2:222312483-222312505 CTGCGGTCGCAGAGTAAGCAGGG + Intergenic
946698606 2:222386832-222386854 TTTGGGAAGCAGAGAAAGGAAGG - Intergenic
946721691 2:222615568-222615590 ATGTAGGAGCAGAGTAAGCATGG - Intronic
1168925177 20:1573534-1573556 ATGTGAGAGCACAGTAAGGAGGG + Intronic
1168929054 20:1606562-1606584 ATGTGAGAGCACAGTAAGGAGGG + Intronic
1169641332 20:7755905-7755927 CTGGGATAGCATAATAAGGAGGG - Intergenic
1171004876 20:21454527-21454549 ATGGGCTAGCAGAGGGAGGGAGG + Intergenic
1172057118 20:32161922-32161944 GTGGGGTCACAGAGTTAGGAGGG - Intronic
1173153307 20:40586377-40586399 ACAGGGTAGCAGAGTCAAGAGGG - Intergenic
1173256577 20:41398169-41398191 ATGGGGGAGCTGACTAGGGAGGG - Intergenic
1173370054 20:42427163-42427185 ATGGGGGAGAAGAGGAGGGATGG - Intronic
1173946494 20:46955040-46955062 ATGGGTGAGCAGAGGAAGGCAGG + Intronic
1175335481 20:58193236-58193258 AGAAGGTAGCAGAGCAAGGAGGG + Intergenic
1175891491 20:62317969-62317991 GTGGGGAAGAAGAGAAAGGAAGG + Intronic
1177558540 21:22721039-22721061 CTGGGTTAGAAGAATAAGGATGG + Intergenic
1178719745 21:34997998-34998020 ATGGGGGAGGAGAGTAGAGATGG - Intronic
1180012171 21:45058513-45058535 AGGGGGTCGCAGAGTGGGGAGGG + Intergenic
1181103473 22:20557237-20557259 ATAGGGTAGGAGTGTGAGGATGG - Intronic
1182287429 22:29256671-29256693 ATGGGGTAGGGGAGCATGGAAGG + Intronic
1182453290 22:30433746-30433768 ACGGGGTGGCAGAGTGGGGAGGG - Intergenic
1183108010 22:35628501-35628523 CTGTGTTAGCAGAATAAGGATGG - Intronic
1184407353 22:44307748-44307770 CTGGGGAAGGAGAGGAAGGAGGG + Intronic
1185014052 22:48333257-48333279 AAGGGGAAGCAGAGTGAGGCTGG - Intergenic
949295321 3:2514917-2514939 AGGGGGTAGCAGAAGATGGAGGG - Intronic
949940177 3:9148724-9148746 ATGGGGTAGTGGAGAAAGGATGG - Intronic
950276648 3:11666942-11666964 ATGAGGAAGCGGAGTCAGGAAGG - Intronic
950613262 3:14139454-14139476 ATGAGGGAGCAGAGGAAGGCAGG + Intronic
950835422 3:15914525-15914547 ATGTGAGAGCACAGTAAGGAGGG + Intergenic
952272152 3:31843628-31843650 TTGGGGCAGCAAAGGAAGGAGGG - Intronic
952415749 3:33090294-33090316 CAGGGGTAGCTGAGAAAGGATGG + Intronic
953927923 3:46991763-46991785 ATAGGGCAGCATAGGAAGGAAGG + Intronic
955829154 3:62982985-62983007 AGGAGGAGGCAGAGTAAGGAAGG + Intergenic
956822415 3:72965785-72965807 CTGGGGTAGAGGAGTAGGGAGGG + Intronic
958258326 3:91350993-91351015 ATTGGGAGGCAGAGAAAGGAGGG - Intergenic
958456877 3:94343402-94343424 ATGCTGTAGCAAAGGAAGGAAGG - Intergenic
958900780 3:99884052-99884074 ATGGGCTAGGAGAGTGAGAATGG + Intronic
959388886 3:105748439-105748461 TGGGGGTAGCAGGATAAGGACGG - Intronic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960299031 3:115979171-115979193 ATGGGGAAGAAGAGCAAAGAGGG + Intronic
960723477 3:120647313-120647335 AAGGGGTAGCAGAAATAGGATGG + Intronic
962193260 3:133333331-133333353 ATGGATAAGCAGAGTAAAGAAGG - Intronic
963068367 3:141281665-141281687 ATGGGGTGGCAGATCAGGGAAGG + Intronic
965265412 3:166536705-166536727 ATGTGGTAGCAAGGTATGGAGGG - Intergenic
966093985 3:176175812-176175834 ATGGGGCAGTAGAATAAGTATGG - Intergenic
966460171 3:180167597-180167619 ATGGGGTGGGAGAGTGGGGAGGG + Intergenic
966568641 3:181413423-181413445 AAGGGCAAGCAGAGGAAGGAAGG + Intergenic
967861593 3:194155997-194156019 GTAGGGAAGCAGAGGAAGGAAGG + Intergenic
968530199 4:1087212-1087234 ATGGGGTAGGGGAGAGAGGACGG + Intronic
968914484 4:3491356-3491378 CAGGGGGAGCAGAGGAAGGAAGG - Intronic
968963286 4:3756558-3756580 ATGGGGCATCAGCGTAAGGGAGG + Intergenic
969479302 4:7439148-7439170 ATGGGGTGAAAGAGGAAGGAAGG + Intronic
970361734 4:15316093-15316115 ATGGGGGAGGAGAGTATGGCTGG - Intergenic
972708448 4:41569436-41569458 ATGGGGTATCTGAGTGATGAAGG - Intronic
976084745 4:81395849-81395871 ATGGGGTAGCAGAGTGGCCAAGG - Intergenic
976332362 4:83846873-83846895 ATGGACTAGCAGAGAATGGAAGG + Intergenic
977848006 4:101789300-101789322 ATTGTGGAGCAGAGTCAGGATGG + Intronic
979585526 4:122410980-122411002 GTGGAGTAGTAGAGAAAGGATGG + Intronic
979626512 4:122851038-122851060 ATGGGGGAGCAGGGGAAGTAGGG - Intronic
980735724 4:136884509-136884531 AGTGGCTGGCAGAGTAAGGAAGG - Intergenic
981403176 4:144338091-144338113 ATGGGGTGGGAAAGAAAGGAAGG - Intergenic
982277934 4:153656013-153656035 AAGGGGTGGCAGAGGGAGGATGG - Intergenic
982659855 4:158193516-158193538 ATGGGGTATGAGAGAAATGATGG + Intergenic
984006273 4:174313774-174313796 AGGGTGAAGGAGAGTAAGGAAGG + Intronic
984939098 4:184916045-184916067 TTGGGATTGTAGAGTAAGGATGG + Intergenic
985062324 4:186091818-186091840 ATGGGGTATCTGAGTAAGAAGGG + Intergenic
985290866 4:188385832-188385854 TTTGGGTAGCAGAGTAATGCTGG + Intergenic
986470375 5:8067830-8067852 ATGAAGTAGGAGAGAAAGGAGGG + Intergenic
989748830 5:44866297-44866319 ATGGGAGAGCAGAGGAAGGAGGG - Intergenic
991534750 5:67656000-67656022 ATGGGGTAACAGAGGTAGGGTGG + Intergenic
992202925 5:74401734-74401756 ATGGGGAAGCTGAGTCAGGGAGG - Intergenic
992578378 5:78144623-78144645 ATGGGGTGCCAGAGAAAGGGTGG + Intronic
992765029 5:79990857-79990879 CTGGGGATGCAGAGTAGGGAGGG + Intronic
993322559 5:86490658-86490680 GTGAGGGAGCAGAGGAAGGATGG - Intergenic
994294814 5:98078178-98078200 ATGGGGTTGAAGAGGAGGGAGGG + Intergenic
994450135 5:99930343-99930365 ATGTGGTGGCAGAATAAAGAGGG - Intergenic
995337987 5:111024551-111024573 ATGGGGCAGAAGAGAAAGGAAGG - Intergenic
995744068 5:115385252-115385274 AAGGGGTAGCAGGGTTAGAAAGG + Intergenic
996317254 5:122174086-122174108 ATGGCATAACAGAGTAAGGAGGG - Intronic
999108370 5:149093704-149093726 GTGGGGGAGCAGAGCAAGGCTGG - Intergenic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1001918329 5:175580622-175580644 ATGGGACAGGAGAGTCAGGAGGG + Intergenic
1002640256 5:180627322-180627344 CTGGGGTCGCAGAGTGAGGCAGG + Intronic
1003873154 6:10417227-10417249 ATGGGGTGGCAGAGGATGGAGGG - Intronic
1004160853 6:13211643-13211665 GTGGGGAACCAGAGAAAGGAAGG - Intronic
1006641637 6:35492406-35492428 CTGGGGCAGCAGAGCAAGTAGGG + Intronic
1007618356 6:43196035-43196057 ATGTGAAAGCAGAGTGAGGAGGG - Intronic
1008096047 6:47340547-47340569 GTGTGGTTGCAGAGTAAGGAAGG + Intergenic
1008370374 6:50724127-50724149 ATGGGGGAGGAGGGTTAGGAAGG + Intronic
1008507624 6:52246399-52246421 CTGGGGCAGCAGAGCCAGGACGG + Intergenic
1009185445 6:60569027-60569049 ATTGGGAGGCAGAGGAAGGAGGG + Intergenic
1009354494 6:62725107-62725129 ATTGGGTATCAGAGTAATGCTGG + Intergenic
1009513347 6:64581283-64581305 CTGGGGTGGTAGAGTAGGGAAGG + Intronic
1010966426 6:82214144-82214166 ATGGGGTTTCACAGTAAGGGTGG + Intronic
1011211517 6:84960490-84960512 ATGAGGTAGCAGAGTGGGCAAGG + Intergenic
1011704393 6:89986167-89986189 ATGGGGGAGCTCTGTAAGGATGG + Intronic
1012603316 6:101126081-101126103 ATTCGGTAGTAGTGTAAGGAGGG + Intergenic
1012938486 6:105392394-105392416 ATGGGATATCAGAGTAACCATGG - Intronic
1013456667 6:110335886-110335908 ATGGGGTAGTGGAGCAAGTATGG - Intronic
1013878298 6:114861884-114861906 GTGGGGAAGCAGAGCAGGGAAGG + Intergenic
1015495461 6:133877755-133877777 ATTGTGAAGCAGAGGAAGGAAGG + Intergenic
1015519124 6:134114122-134114144 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
1017034288 6:150253057-150253079 ATAGGGTGGCTGAGTAGGGATGG - Intergenic
1017103482 6:150867062-150867084 ATGGGAGAGCAGAGGGAGGAAGG - Intronic
1018377122 6:163223511-163223533 ATGGGAAAGCAGAAGAAGGATGG + Intronic
1018829556 6:167432932-167432954 ATGGGGTGGCAGAGTGTGGATGG + Intergenic
1018829681 6:167433462-167433484 GTGGGGTGGCAGAGTGTGGATGG + Intergenic
1019855860 7:3606667-3606689 ACGGGGTATCTGAGTAAGAAAGG - Intronic
1022325038 7:29323413-29323435 CTGTGGTAGCAGAATAATGAGGG - Intronic
1025218615 7:57083693-57083715 ATGGAGTAGAAGAGTAAGTTTGG + Intergenic
1025629538 7:63257292-63257314 ATGGAGTAGAAGAGTAAGGTTGG + Intergenic
1025652731 7:63486746-63486768 ATGGAGTAGAAGAGTAAGGTTGG - Intergenic
1026131933 7:67628144-67628166 GAGGGGTAGCGGAGTCAGGAGGG - Intergenic
1028225673 7:88249994-88250016 GGGGGGTAGAAGAGTAGGGATGG - Intergenic
1029111894 7:98217019-98217041 CTGGGGCAGCAGAGCCAGGATGG - Exonic
1030273462 7:107694520-107694542 ATCTGGTAGCAGAGTAGTGAAGG - Intronic
1030659587 7:112205717-112205739 TTGGGGAAGAAGGGTAAGGAAGG + Intronic
1030699150 7:112619774-112619796 AGAGGGGAGAAGAGTAAGGAAGG - Intergenic
1032252728 7:130271895-130271917 ATGGAGTAGCAGATGCAGGAAGG - Intronic
1032618776 7:133504980-133505002 ATGGGTTGGCAGAGTCAGGTCGG + Intronic
1032622941 7:133556573-133556595 ATGGGGTACCGCGGTAAGGATGG + Intronic
1033195228 7:139321782-139321804 CTGGGGAAGCAGGGGAAGGAAGG - Intergenic
1033588430 7:142791489-142791511 ATGGGACAGCATAGAAAGGAGGG + Intergenic
1037732715 8:21541730-21541752 ATGGGGCAGGAGAGGAAGCAAGG + Intergenic
1038129217 8:24710663-24710685 ATGGAGGAACAGAGTAAGGAGGG + Intergenic
1038426622 8:27468197-27468219 TTGGGGTGGCAGGGCAAGGAAGG - Intronic
1038948674 8:32390105-32390127 ATGGGAAAGCAGAGTGAAGAGGG - Intronic
1040626677 8:49157676-49157698 ATAGGGGAGCAGAGTAAGGAGGG + Intergenic
1041051748 8:53941046-53941068 GTGAGGCAGCAGAGAAAGGAGGG - Intronic
1041313376 8:56538425-56538447 ATGGGGTGGGAGACTAAGGAAGG + Intergenic
1042723319 8:71846600-71846622 ATGGAGTAGAAGAGAAAGGGAGG - Intronic
1043848602 8:85190088-85190110 ACGAGGTGGCAGAGGAAGGAGGG - Intronic
1044035582 8:87299250-87299272 ATGTGGAAGGAGAGGAAGGAAGG - Intronic
1044277299 8:90316778-90316800 AGGTGGTTGCAGAGCAAGGAGGG - Intergenic
1044321315 8:90804741-90804763 ATGAGGGAGAAGAGTAAGGTGGG - Intronic
1044337398 8:91003563-91003585 ATTGGTTTGCAGAGTAAGGTGGG + Intronic
1044962541 8:97544909-97544931 ATGGGGTCAAAGAGGAAGGAGGG + Intergenic
1047304603 8:123642694-123642716 ATGGGGTAGCAGTGGAAGCAGGG + Intergenic
1047721540 8:127644801-127644823 AAGGGGTAGAAGAGTAAGTGGGG - Intergenic
1047929187 8:129709750-129709772 ATGGGGTTGGAAAGTAATGATGG - Intergenic
1048206297 8:132417924-132417946 AGAGGGCAGCAGAGTGAGGATGG + Intronic
1048607946 8:135989694-135989716 ATGGGGCAGCACAGTGAAGATGG - Intergenic
1048610425 8:136016329-136016351 ATGGGGTAGTAGCATAAGAAAGG + Intergenic
1050226185 9:3458502-3458524 ATGGAGTAGAAGAGTAATGGAGG + Intronic
1050276584 9:4007406-4007428 ATCTGGTACCAGGGTAAGGAAGG - Intronic
1054733115 9:68721517-68721539 ATATGGTAGCAGAGGCAGGAGGG + Intronic
1055129360 9:72756677-72756699 AAGGCATAGCAGAGAAAGGAAGG + Intronic
1060400462 9:123345939-123345961 ATTGAATAGCAGAGGAAGGAAGG + Intergenic
1060976856 9:127770179-127770201 ATGGGGATGAAGAGGAAGGAGGG - Intronic
1061048043 9:128177992-128178014 ATGGGGAAACAGACTCAGGAGGG + Intronic
1061111215 9:128572680-128572702 AAGTGGTAGCAGAGGAAGGTGGG + Intronic
1186289503 X:8081019-8081041 ATGGGGAAGCAGAGCACAGAAGG + Intergenic
1186839522 X:13471211-13471233 AAGGAAAAGCAGAGTAAGGAGGG + Intergenic
1187260775 X:17683392-17683414 ATGGGGTAGGGGAGTGAGAATGG - Intronic
1187505804 X:19877400-19877422 AGGGGGCAGCAGAGCAAGAATGG + Intronic
1187733613 X:22281855-22281877 AAGGGAAAGCAGAGTAAGTAAGG - Intergenic
1188016864 X:25115754-25115776 ATGGGGTATCAGAGAAAGCCAGG - Intergenic
1188418904 X:29972567-29972589 TAGGGGTAGCAGATTAAAGATGG + Intergenic
1188905313 X:35784538-35784560 AGTGGGAAGCAGAGTAAGCAGGG + Intergenic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1189417656 X:40829285-40829307 TTGGGGTAGAAGAGTGGGGAGGG + Intergenic
1189857612 X:45239026-45239048 AAGGGGAAATAGAGTAAGGAAGG - Intergenic
1190061445 X:47214437-47214459 GTGGGGTGACAGAGTAAGGGAGG - Intronic
1194762899 X:97815482-97815504 ATGAAATAGCAGAGAAAGGATGG + Intergenic
1194956724 X:100189655-100189677 AGGGGGTATCAGAGTGTGGAGGG + Intergenic
1195849721 X:109270174-109270196 CTGGGATAGCAGTGTGAGGATGG - Intergenic
1196020418 X:110985215-110985237 ATGAGGTTGCAGAGGAAGGCAGG - Intronic
1197678881 X:129361115-129361137 ATAGGGCAGCAGGGGAAGGATGG - Intergenic
1197718083 X:129724584-129724606 AAGGGAGAGCAGAGGAAGGAGGG + Intergenic
1198801552 X:140452791-140452813 CAGGGGTAGCAGAGGCAGGAAGG + Intergenic
1199593843 X:149491719-149491741 AGGGGCTAGCATAGGAAGGAGGG - Intronic
1199885778 X:152020693-152020715 GTGGGTTAGAAAAGTAAGGAAGG + Intergenic
1201897177 Y:19004376-19004398 CTGGGAAAGCAGAGTGAGGAGGG + Intergenic
1201983848 Y:19939723-19939745 ATGAGGTTGCAGAGGAAAGAGGG - Intergenic