ID: 1138064136

View in Genome Browser
Species Human (GRCh38)
Location 16:53923067-53923089
Sequence TTAGGCTGCTTGGAAAACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 568
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 537}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138064136 Original CRISPR TTAGGCTGCTTGGAAAACAG AGG Intronic
902624520 1:17668820-17668842 TCCTGCTGCTTGGAATACAGGGG + Intronic
903732597 1:25507285-25507307 TTAGGCTGCTCGGGGATCAGGGG - Intergenic
903975981 1:27150578-27150600 TTAGGCTATTGGGAAAACTGTGG - Intronic
904567466 1:31436172-31436194 TCAGGCTGCTCTGAAGACAGGGG - Intergenic
904578587 1:31522995-31523017 TGAGGCTGCCTGCAGAACAGAGG + Intergenic
905371602 1:37485425-37485447 TGAGGCTGCCTGGAAAAAATAGG + Intergenic
907926422 1:58958833-58958855 TTAGGCTGCTTGGGGTTCAGGGG - Intergenic
907991553 1:59587509-59587531 TTAGGCTGCTTGGGGGTCAGGGG - Intronic
909441236 1:75698343-75698365 TTAGGCTGCTCGGGGATCAGGGG - Intergenic
909645351 1:77910951-77910973 TTTGGCCACTTGGGAAACAGAGG - Intronic
910695929 1:90015696-90015718 TAAGGGTGCATGGAAATCAGGGG + Intronic
910808462 1:91211619-91211641 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
910815454 1:91287351-91287373 TTAGGCTGCTTGGGGGTCAGGGG - Intronic
911033090 1:93510298-93510320 TTAGGCTGCTTGGGGGTCAGGGG - Intronic
911826295 1:102489229-102489251 TCAGGCTGCTTGGTTATCAGAGG + Intergenic
912737128 1:112160102-112160124 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
913166662 1:116193485-116193507 TTAAGCTGCTAGGAAAATATGGG + Intergenic
913299691 1:117357993-117358015 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
913931251 1:124967142-124967164 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
913933377 1:125008433-125008455 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
914410664 1:147423922-147423944 TTAGGCTGCTCGGGAGTCAGGGG - Intergenic
915761656 1:158319963-158319985 TTAGGCTGCTCGGGAGTCAGGGG + Intergenic
915861902 1:159453657-159453679 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
916402099 1:164459906-164459928 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
916903569 1:169256865-169256887 TTAGGCTGCTTGGGGGTCAGGGG + Intronic
916905525 1:169279114-169279136 TTAGGCTGCTTGGGGGTCAGGGG + Intronic
916977272 1:170094475-170094497 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
917182539 1:172314953-172314975 TTAGGCTGCTCGGGAGTCAGGGG - Intronic
917547997 1:175992956-175992978 TTAGGCTGCTTGGGGGTCAGGGG - Intronic
917581405 1:176381871-176381893 TGAGACTGCTGGGAATACAGTGG - Intergenic
918086660 1:181251329-181251351 TTGGGCTCCTTGCAAAACAGGGG + Intergenic
918411695 1:184265633-184265655 TCCAGCTGCTTGGAAAACTGAGG + Intergenic
920506509 1:206518886-206518908 ATAGGCAGAATGGAAAACAGTGG - Intronic
920753357 1:208703401-208703423 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
923304529 1:232675900-232675922 TTAGCCTGAATGGAACACAGGGG + Intergenic
1063344272 10:5296676-5296698 TTTGGTTGCTTAGAAAACACTGG + Intergenic
1063554266 10:7063335-7063357 TTAGGCTGCTCGGGAGTCAGGGG + Intergenic
1064214240 10:13386252-13386274 TAAGGCTTCTTGGACAGCAGTGG + Intergenic
1064687797 10:17882248-17882270 TTATACAGCTTGGAAAAGAGAGG + Intronic
1066001837 10:31111812-31111834 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
1067906357 10:50294988-50295010 ACAGGCTGCTTGGAAGTCAGAGG + Intergenic
1068001019 10:51334543-51334565 TTAGATTGCTTGAAATACAGTGG - Intronic
1068179171 10:53499305-53499327 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
1068759683 10:60693590-60693612 TTAGGCTGCTTGGGGGTCAGGGG - Intronic
1069173315 10:65259967-65259989 ATAGGCTGCTGAGAACACAGCGG - Intergenic
1069979900 10:72245121-72245143 TTAGGCAAATAGGAAAACAGAGG + Intergenic
1071912474 10:90251317-90251339 TTAGGCTGCTTGGAGGTCAGGGG - Intergenic
1072525424 10:96266977-96266999 TTTGGCAGCTGGGAAAACTGAGG + Intronic
1072819483 10:98542040-98542062 TTAGGCTGCTTGGGGGTCAGGGG - Intronic
1072855116 10:98937801-98937823 TTAGGCTGCTTGGGGGTCAGGGG - Intronic
1073667593 10:105550908-105550930 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
1074286741 10:112104629-112104651 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
1075379818 10:122009928-122009950 TAAGGTTGCCTGGGAAACAGAGG + Intronic
1076281716 10:129252006-129252028 TGAGGCCACTTTGAAAACAGTGG - Intergenic
1076485579 10:130814305-130814327 TTTGGTTTCTTGGAAAACACAGG - Intergenic
1077606904 11:3618421-3618443 TTAGGCTGCTGTGAGAACGGAGG - Intergenic
1077673178 11:4175547-4175569 TTAGGCTGCTCGGGAGTCAGGGG + Intergenic
1078094760 11:8289939-8289961 GGGGGCTGCTGGGAAAACAGAGG + Intergenic
1078990679 11:16643425-16643447 TCTGGCAGCTTGGAAGACAGTGG - Intronic
1079291704 11:19193988-19194010 CTAGGCTTCTTAGAAACCAGAGG - Intronic
1079575819 11:22001773-22001795 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
1079598722 11:22285476-22285498 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
1079964655 11:26965818-26965840 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
1079988286 11:27220405-27220427 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
1080634943 11:34115594-34115616 TTAGGATGCTAGGAAAAATGTGG + Intronic
1081039444 11:38192447-38192469 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
1081427501 11:42941033-42941055 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
1081588762 11:44406381-44406403 TTTTGCAGATTGGAAAACAGAGG - Intergenic
1082315160 11:50708714-50708736 TTAGGCTGCTTGGGGTTCAGGGG + Intergenic
1082317758 11:50750543-50750565 TTTGGCTGCTTGGGGATCAGGGG + Intergenic
1082606321 11:55238255-55238277 TTAGGCTGCTCGGAGGTCAGGGG + Intergenic
1084001909 11:66300393-66300415 TGAGGCTGCGTGGAGAACTGAGG + Intergenic
1085222017 11:74882812-74882834 TTAGGCTGCTTGGGGGTCAGGGG + Intronic
1085767062 11:79292350-79292372 TTGAGCTCCATGGAAAACAGTGG - Intronic
1085783285 11:79428836-79428858 TTATGCTGCTTTGAAAATGGAGG + Intronic
1086175338 11:83884659-83884681 TTAGGCTGCTTGGTAGTCAGGGG - Intronic
1087067151 11:94037559-94037581 TTAGGCTGCTTGGGGGTCAGGGG - Intronic
1087352105 11:97045563-97045585 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
1087598770 11:100286446-100286468 TTAGGCTGCTTGGGGGTCAGGGG - Intronic
1087608861 11:100409751-100409773 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
1087612638 11:100452562-100452584 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
1087615339 11:100481019-100481041 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
1087680635 11:101215189-101215211 TTGGGCTACTTGCCAAACAGGGG - Intergenic
1087704546 11:101475182-101475204 TAAGCCTGGTTGGGAAACAGTGG + Intronic
1088370476 11:109083496-109083518 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
1088844975 11:113657308-113657330 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
1088958766 11:114638893-114638915 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
1089145376 11:116326084-116326106 CTGGGCAGCTTGGAAAACAATGG - Intergenic
1089179387 11:116570957-116570979 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
1089886007 11:121824418-121824440 TTAGGCTGCTCGGGAGTCAGGGG - Intergenic
1090232499 11:125118655-125118677 TTATGCTGTCAGGAAAACAGAGG - Intergenic
1090251685 11:125256073-125256095 TTAGCCTGCTGGGAAGACGGTGG + Intronic
1090857208 11:130620906-130620928 TTAGGCTGCAAGGAAAAAAAAGG - Intergenic
1091062792 11:132479715-132479737 TTAGGCTGCTTGGGGGTCAGGGG - Intronic
1092073231 12:5650512-5650534 TTTGGCAGCTTGGAAGACAGTGG - Intronic
1093697141 12:22173440-22173462 TTAGGCTGATAAGAAAACAAAGG - Intronic
1093986285 12:25537413-25537435 TTAGGCTGCTTGGGGGTCAGGGG - Intronic
1094282992 12:28760931-28760953 TTAGGCTGCTCGGGGATCAGGGG - Intergenic
1094377879 12:29810430-29810452 TTAGGCTGCTCGGGGATCAGGGG - Intergenic
1094744812 12:33332555-33332577 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
1094786038 12:33848833-33848855 TTAGGCTGCTTGGGTGTCAGGGG - Intergenic
1095033379 12:37323182-37323204 TTAGGCTGCTTTGGGATCAGGGG + Intergenic
1095060471 12:37682313-37682335 TTAGGCTGTTCGGAGACCAGGGG - Intergenic
1095241442 12:39864413-39864435 TTACTTTGCTTGGAACACAGAGG + Intronic
1095385237 12:41642716-41642738 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
1095388061 12:41673149-41673171 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
1095677079 12:44932405-44932427 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
1095911175 12:47427603-47427625 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
1096262365 12:50100861-50100883 CTAGGCTGCTTGGACCACTGGGG - Intergenic
1096828971 12:54300177-54300199 CTTGGCTGCTTGGGAAATAGGGG - Intronic
1097304962 12:58058971-58058993 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
1097344561 12:58476834-58476856 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
1097528351 12:60766759-60766781 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
1097863627 12:64542286-64542308 TTAGGCTGGATGGAGTACAGTGG - Intergenic
1098675838 12:73288958-73288980 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
1099880960 12:88466659-88466681 TTAGGCTGCTCGGGAGTCAGGGG + Intergenic
1100035457 12:90245727-90245749 TTAGACTGCTTGGTGAACTGTGG - Intergenic
1100238300 12:92683628-92683650 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
1100562182 12:95758602-95758624 TTGGGCTGGCTGGAGAACAGTGG + Intronic
1100919308 12:99464004-99464026 TTAGGCTGCTTGGGGGTCAGGGG - Intronic
1101189118 12:102313060-102313082 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
1101240363 12:102832483-102832505 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
1101591948 12:106132606-106132628 TGAGGCTGCTTGGGAAACAAAGG + Intronic
1101833321 12:108276397-108276419 TCAGCCAGCTTGGAAAAGAGGGG - Intergenic
1102309521 12:111834592-111834614 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
1105311489 13:19216150-19216172 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
1105403263 13:20113749-20113771 TTAGGTTACTTGGCAAACTGGGG + Intergenic
1105578295 13:21672756-21672778 TTAGGCTCCGTGAAAAGCAGGGG + Intronic
1105598315 13:21861182-21861204 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
1105667408 13:22575437-22575459 TTAGGCTGCTCGGAGGTCAGGGG - Intergenic
1106444508 13:29814567-29814589 TTACAGTGCTTGGAAAAGAGTGG - Intronic
1107231247 13:38112836-38112858 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
1107489726 13:40869876-40869898 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
1108547319 13:51508738-51508760 TCTGGATGCTAGGAAAACAGTGG - Intergenic
1109320587 13:60805304-60805326 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
1110353335 13:74537062-74537084 TTAGGCTGCTCGGGGATCAGGGG - Intergenic
1110813902 13:79840366-79840388 TTAGGCTGCTCGGGAGTCAGGGG - Intergenic
1111227278 13:85290176-85290198 TTTCGTTGCTTGGAAAACACTGG + Intergenic
1111616259 13:90664688-90664710 TTAGGCTGCTCGGGAGTCAGGGG - Intergenic
1111917178 13:94372904-94372926 TTAGGCTGCTTGGGGGTCAGGGG - Intronic
1112489816 13:99851756-99851778 TTAGCCACTTTGGAAAACAGCGG + Intronic
1112690888 13:101892681-101892703 ATAGTGTGCTGGGAAAACAGTGG + Intronic
1113107087 13:106783677-106783699 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
1114003750 14:18289139-18289161 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
1115868220 14:37772105-37772127 TTAGGCTGCTCGGGGATCAGGGG + Intronic
1116042543 14:39703014-39703036 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
1117663600 14:58033242-58033264 TTAGGCTGCTTGGGGGTCAGGGG - Intronic
1118006806 14:61570510-61570532 TTAATCTTCTGGGAAAACAGAGG + Intronic
1118246155 14:64113143-64113165 ATCGGCTGCTTGGAAACCTGTGG + Intronic
1119057591 14:71438860-71438882 TTGGGCTGGTTGGAAAGCCGTGG + Intronic
1119431664 14:74572146-74572168 TGAGGCTGCTTGGGACCCAGAGG - Intronic
1119608972 14:76045698-76045720 TTCTTCTGCCTGGAAAACAGAGG - Intronic
1119985361 14:79131479-79131501 TTAGGCTGCTTGGGGGTCAGGGG + Intronic
1120002145 14:79314755-79314777 TTAGGCTGCTTGGGGGTCAGGGG - Intronic
1120371357 14:83640014-83640036 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
1120404539 14:84078572-84078594 TTATGGTACTTGGAAAACTGAGG - Intergenic
1120410232 14:84144982-84145004 TTTGGCTGCTTGGTAAGCACAGG + Intergenic
1121885095 14:97535583-97535605 TCAGGATGCCTGGAAAACACAGG + Intergenic
1123444118 15:20311729-20311751 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
1123684265 15:22786474-22786496 TTAGGCTGCGGGGACAGCAGTGG - Intronic
1125218692 15:37308705-37308727 TTAGGCTGCTCGGGGATCAGGGG + Intergenic
1125937728 15:43650661-43650683 TTAGGCTGCTTGGGGGTCAGGGG - Intronic
1126493449 15:49265002-49265024 TTAGGCTGCTTGGGGGTCAGGGG + Intronic
1126548703 15:49903365-49903387 TTACGCAGCTTGGAAAAAACAGG - Intronic
1127303476 15:57680158-57680180 TTAGGTAGCTGGGAAAGCAGTGG - Intronic
1128663673 15:69522807-69522829 TTTGGTTAATTGGAAAACAGTGG + Intergenic
1129622116 15:77157264-77157286 TTAGACTGTTTGGAAACCAGTGG - Intronic
1129837537 15:78720535-78720557 TTAGGCTGCTCGGGGATCAGGGG - Intronic
1131092825 15:89635017-89635039 TTAGGCTGCTCGGAGGTCAGGGG - Intronic
1133686503 16:8170240-8170262 TTAGGCTGGGAGGAAAAAAGGGG + Intergenic
1136992282 16:35160857-35160879 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
1137025459 16:35469375-35469397 TTAGGCTGCTCGGGAGTCAGGGG - Intergenic
1137081983 16:36072624-36072646 TTAGGCTGCTTGGGGATCAGGGG - Intergenic
1137221338 16:46454706-46454728 TTAGGCTGCTCGGGGATCAGGGG + Intergenic
1138064136 16:53923067-53923089 TTAGGCTGCTTGGAAAACAGAGG + Intronic
1138746004 16:59363907-59363929 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
1139271836 16:65690702-65690724 TTAGGCTGCTCGGGGATCAGGGG - Intergenic
1139297992 16:65919477-65919499 TTTGTCTGCTGGGAAAATAGCGG + Intergenic
1140074207 16:71682082-71682104 ATAAGCTGCTTGAAAAACAAGGG + Intronic
1144878501 17:18417245-18417267 TGATGCTGCTTGGTAAACACTGG - Intergenic
1144885250 17:18453994-18454016 TGATGCTGCTTGGTAAACACTGG + Intergenic
1145146967 17:20490382-20490404 TGATGCTGCTTGGTAAACACTGG - Intergenic
1145153733 17:20527142-20527164 TGATGCTGCTTGGTAAACACTGG + Intergenic
1146205968 17:30906065-30906087 GTAGGGTGCTTGGAACACTGGGG - Intronic
1146205985 17:30906145-30906167 GTAGGGTGCTTGGAACACTGGGG - Intronic
1146610103 17:34297751-34297773 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
1146611349 17:34307785-34307807 TTTTGCTGATAGGAAAACAGTGG + Intergenic
1146659984 17:34659166-34659188 TCAGGCTGCTCTGGAAACAGAGG - Intergenic
1148725196 17:49784185-49784207 TTAGGCAGCTTACAAAACTGAGG + Intronic
1149196937 17:54132611-54132633 TTAGGCTGCATGGGGATCAGGGG + Intergenic
1149371939 17:56003095-56003117 TTAGGCTGCTTGGGGCTCAGGGG - Intergenic
1149408665 17:56381000-56381022 TTAGGCTGCTTGGAGGTCAGGGG - Intronic
1150324822 17:64248478-64248500 TGACACTGCTTAGAAAACAGTGG - Intronic
1152458510 17:80429525-80429547 CTAGGCTGCTTTGAGAACTGAGG + Intronic
1152512184 17:80797984-80798006 CTTGGCTGCCTGGAACACAGGGG - Intronic
1153853606 18:9122067-9122089 GTAGGCTGTTTGGAAAAAATTGG + Intronic
1155167879 18:23245959-23245981 TTAGGTGGCATTGAAAACAGTGG + Intronic
1156228307 18:35130391-35130413 TGTGGCTGCTTGCAAAGCAGTGG - Intronic
1157397271 18:47353529-47353551 TTAGGCTGCTTGGGGGTCAGAGG + Intergenic
1157708166 18:49826809-49826831 TTAGGCTTCTTGGAGATCAGAGG + Intronic
1157844046 18:50985872-50985894 TTAGTCTTCTTGGCAGACAGGGG - Intronic
1158043633 18:53128543-53128565 TTATGGTGCTTTGAAAACACTGG - Intronic
1158853000 18:61514801-61514823 TTAGGCTGCTTGGGGGTCAGGGG + Intronic
1159442437 18:68498718-68498740 TTAAGCTGCTTTTAAAAGAGGGG + Intergenic
1159778448 18:72631527-72631549 ATTGGGTGCTTGGAAAACATGGG + Intronic
1161314045 19:3609581-3609603 TTTGGCTGCTCGGGAAACTGAGG - Intergenic
1163032259 19:14552486-14552508 TTACGTGGCTTGGAAAACTGGGG - Intronic
1164321571 19:24152978-24153000 TTAGGCTGCTTGGGGTTCAGGGG + Intergenic
1164340714 19:24394742-24394764 TTAGGCTGCTTGGGTGTCAGCGG - Intergenic
1165760235 19:38316723-38316745 CGAGGCAGCCTGGAAAACAGAGG - Intronic
1166429809 19:42714994-42715016 TTAGGCTGCTCGGGGATCAGGGG - Intronic
1166433742 19:42749373-42749395 TTAGGCTGCTCGGGAGTCAGGGG + Intronic
1166489572 19:43247379-43247401 TTAGGCTGCTTGGGGGTCAGGGG + Intronic
1166578317 19:43866585-43866607 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
1168369876 19:55823103-55823125 TTAGGCTGCTTGGGGGTCAGGGG - Intronic
1202653441 1_KI270707v1_random:26789-26811 TTAGGCTGCTTGGGGGCCAGGGG - Intergenic
925470780 2:4158513-4158535 TTAGGCTGCTTGGGGTTCAGGGG - Intergenic
926494373 2:13566659-13566681 TTGGGCTGCTTAGAACAAAGGGG + Intergenic
926976282 2:18519981-18520003 TCAGGCTGTTTGGAAGACAGGGG + Intergenic
927096099 2:19748526-19748548 AGAGGCTGCCTGGAAAACAGTGG - Intergenic
927425460 2:22976637-22976659 ATAGGCTGCTTGGACAACCAAGG + Intergenic
928871744 2:35988721-35988743 TTAAGCTACTTGGGAGACAGAGG + Intergenic
930473859 2:51854139-51854161 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
932077547 2:68679349-68679371 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
932114479 2:69033909-69033931 TTAAGCTCCTTAGAAAACACAGG - Intronic
932935360 2:76096078-76096100 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
933550438 2:83769006-83769028 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
933590337 2:84225444-84225466 TTAGGCTGCTTGGGGATCAGGGG - Intergenic
933809162 2:86021711-86021733 TTAGGGTGCCTGGGACACAGTGG + Exonic
933880002 2:86660544-86660566 TTAGGCTGCTTGGGGGTCAGGGG + Intronic
934937380 2:98475234-98475256 TTAGGAAGCTTGGGAGACAGAGG + Intronic
935874309 2:107489096-107489118 TTAGGCTGCCTGGTGAACTGAGG - Intergenic
936442336 2:112565673-112565695 TCAGGCTGCTTGGCAAGCTGAGG - Intronic
937452976 2:122017980-122018002 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
937660106 2:124420937-124420959 TTGGGCTTCTTGGAAATCACTGG - Intronic
938520753 2:132068298-132068320 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
938985102 2:136567476-136567498 TCAGTCTCCTTGGCAAACAGGGG + Intergenic
939077383 2:137620353-137620375 TTAGGCTGCCAGGAAAGCAGAGG - Intronic
939218298 2:139268695-139268717 TTAAGCTTCTTGGTAATCAGAGG + Intergenic
939265852 2:139871998-139872020 TTAGGCAGATAGGAAAAAAGGGG + Intergenic
940864423 2:158803888-158803910 TTAATCTGGTGGGAAAACAGAGG + Intronic
941022145 2:160420318-160420340 TTTGGCTGATGGAAAAACAGAGG - Intronic
941458350 2:165736969-165736991 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
941564248 2:167087244-167087266 TTAGGCTGCTCGGAGGTCAGGGG + Intronic
942176387 2:173338826-173338848 TTAGGCTTTTAGAAAAACAGTGG + Intergenic
942427513 2:175875808-175875830 TTAGGGTGCATGGAAAAATGAGG - Intergenic
944266216 2:197729653-197729675 TTAGGCTGCTTGGGGGTCAGGGG - Intronic
944410102 2:199432074-199432096 TCAGGCTGCTTTGAAAGCACTGG + Intronic
944905656 2:204259372-204259394 TTAGGCAGCAAGGAAAAGAGAGG - Intergenic
945049098 2:205806577-205806599 TTTGGCTGCTTTGAAAAAGGAGG - Intergenic
945822753 2:214684476-214684498 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
946659613 2:221985265-221985287 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
947390008 2:229629139-229629161 ATTTGCAGCTTGGAAAACAGAGG - Intronic
947959791 2:234226404-234226426 AGAGGATGCCTGGAAAACAGTGG - Intergenic
1169853277 20:10076674-10076696 TCAGGCTGCCAGGAAAGCAGTGG - Intergenic
1169905144 20:10595089-10595111 TTGGGCTGCTTGGAGGCCAGGGG + Intronic
1170090339 20:12583210-12583232 TTAGGCTGCTTGGGGTTCAGGGG - Intergenic
1170668013 20:18403515-18403537 TAAGGCTGCTTTCAAAACAATGG + Intronic
1171065446 20:22010132-22010154 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
1171404580 20:24901306-24901328 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
1172269616 20:33647054-33647076 TTAGGCTGACTGGAAAACTGTGG - Exonic
1176112897 20:63418566-63418588 TCAGGCTGCTTGGGGACCAGAGG - Intronic
1176775903 21:13132475-13132497 TCAGGCTGCTTGGAGGTCAGGGG - Intergenic
1177087360 21:16723149-16723171 TTAGTCTGCATTAAAAACAGAGG - Intergenic
1178242121 21:30914909-30914931 TTGGGCTAATTGGAAAAAAGAGG + Intergenic
1180428264 22:15219942-15219964 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
1180565594 22:16661067-16661089 TTAGGCTGCTCGGAGGTCAGGGG - Intergenic
1183164406 22:36136688-36136710 TCAGGCTGCCTGGGGAACAGAGG - Intergenic
1184362435 22:44026409-44026431 TTGGGGTGCCTGGCAAACAGAGG + Intronic
1184931133 22:47682191-47682213 TTGGGCTGCTTGGAATAGACAGG - Intergenic
1185362589 22:50417545-50417567 CTTGGCAGATTGGAAAACAGTGG + Intronic
949875253 3:8622434-8622456 TTTGGCAGCTGGGAAAACTGAGG - Intronic
950914106 3:16626239-16626261 TTAGGCTGTTTGTAACACAAAGG + Intronic
951167373 3:19498882-19498904 TTAGGCTGCTTGGGGGTCAGGGG + Intronic
951561739 3:23974543-23974565 CTAAGGTGCTTGGAAATCAGCGG - Intronic
953133132 3:40160295-40160317 TTAGGCTGCTCGGGGATCAGGGG + Intronic
953289464 3:41647622-41647644 TTAGGCTGCTTGGGGGTCAGGGG + Intronic
953359944 3:42287349-42287371 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
954359679 3:50114166-50114188 TAAGGCTCCCTGGGAAACAGAGG - Exonic
954890857 3:53927050-53927072 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
954950027 3:54464200-54464222 TTAGGCTGCTTGGGGGTCAGGGG + Intronic
954986919 3:54802771-54802793 TTAGGCTGCTTGGGGGTCAGGGG - Intronic
955190175 3:56754396-56754418 TGGGGCTGCTTGGTAAACTGAGG + Intronic
955427505 3:58807279-58807301 TTAGGCTGCTTGGAGGTCAGGGG - Intronic
955748658 3:62165876-62165898 TGAGGCTGTTTGAGAAACAGTGG + Intronic
956095716 3:65713842-65713864 TTTAGCTGCTGGGAAAACAAAGG + Intronic
956729785 3:72186201-72186223 TGAGGGTGCTTTGAAATCAGTGG - Intergenic
957020885 3:75125156-75125178 TTAGGCTGCTCGGAGGTCAGGGG + Intergenic
957101782 3:75837187-75837209 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
957308366 3:78487741-78487763 TTAGGCTGCTTGGAGGTCAGGGG - Intergenic
957601285 3:82338203-82338225 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
957662534 3:83179294-83179316 ATATGCTGCTTGGAAATCAAAGG - Intergenic
957983111 3:87537987-87538009 TTATGGTACTTGGAAAAAAGGGG - Intergenic
958200821 3:90312377-90312399 TTAGGCTGCTCGGGGATCAGGGG + Intergenic
958205651 3:90387730-90387752 TTAGGCTGCTTGGGGATCAGGGG + Intergenic
958407556 3:93767642-93767664 TTAGGCTGCTCGGAGATCAGGGG - Intergenic
959607553 3:108258382-108258404 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
960427807 3:117530418-117530440 TCAGGCTGCTGGGGATACAGTGG + Intergenic
961643127 3:128377552-128377574 TTACGCTGCATTGAAAACAATGG - Intronic
961800314 3:129443002-129443024 CTAGCCTGATTGGAATACAGTGG - Intronic
962019339 3:131480842-131480864 TTATGCCACTTGGAAAACTGAGG + Intronic
962080860 3:132137569-132137591 TTAGGCTGCTTGGGGGTCAGGGG - Intronic
962104438 3:132376537-132376559 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
962238364 3:133729083-133729105 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
962552187 3:136505938-136505960 TTAGTCTGGTTGGAGCACAGAGG + Intronic
962831658 3:139147609-139147631 TTAGGCTGCTTGGGGGTCAGGGG + Intronic
964149501 3:153507107-153507129 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
964325629 3:155542600-155542622 TTAGGCTGCTTGGGGGTCAGGGG - Intronic
964686050 3:159397622-159397644 TTAGGCTGCTTGGGGGTCAGGGG + Intronic
965323663 3:167275969-167275991 TTAGGCTGCTTGGGGGTCAGGGG - Intronic
965974566 3:174605882-174605904 TTAGGCTGCTCGGGGATCAGGGG - Intronic
968636475 4:1683707-1683729 ACAGGCTGCGTGGGAAACAGGGG + Intronic
970065665 4:12090685-12090707 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
970985040 4:22147126-22147148 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
971113431 4:23615476-23615498 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
972119510 4:35682589-35682611 TTAGGCTGCTCGGGGATCAGGGG + Intergenic
973332388 4:48923157-48923179 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
973347538 4:49072628-49072650 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
973399035 4:49621626-49621648 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
973597252 4:52504776-52504798 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
973731672 4:53829062-53829084 TTAGGCTGCTTGGGGGTCAGGGG + Intronic
974530125 4:63097728-63097750 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
974944929 4:68515111-68515133 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
976094068 4:81488961-81488983 ATAGGCTAGTTGAAAAACAGGGG - Intronic
976242957 4:82977603-82977625 GTAGGCAACTTGGAAATCAGTGG - Intronic
976471822 4:85437420-85437442 ATAGGCAGCTAGGAAATCAGGGG - Intergenic
977023897 4:91791331-91791353 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
977678170 4:99770743-99770765 TTAGGCTGCTCGGGAGTCAGGGG + Intergenic
978632470 4:110762908-110762930 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
978639040 4:110846587-110846609 TTAGGCTGCAAGGAAAGAAGTGG + Intergenic
979085631 4:116406408-116406430 TTAGGCTGCTCGGAGGTCAGGGG - Intergenic
979561982 4:122110794-122110816 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
979737750 4:124108809-124108831 TTAGGAAACTTGGAAAAGAGAGG + Intergenic
979948779 4:126866283-126866305 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
980507241 4:133739235-133739257 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
981407835 4:144392259-144392281 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
981544738 4:145882381-145882403 TAATGCTGCTTGCAAAACGGAGG - Intronic
982675244 4:158367976-158367998 TTAGGCTGCTTGGGGGTCAGGGG + Intronic
983407482 4:167348836-167348858 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
983567075 4:169164580-169164602 CTAGGCTGCTGGGAAACCTGGGG + Intronic
984307655 4:178015737-178015759 TTAGGCTGCTTGGTGGTCAGGGG - Intergenic
985389324 4:189478658-189478680 TCAGGCTGCCTGGAAAAAAGAGG + Intergenic
985978254 5:3439612-3439634 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
986132943 5:4947407-4947429 TTATGCTGTTTGGGAAACACAGG - Intergenic
987273347 5:16336113-16336135 TTAGGCTGCTCGGGAGTCAGGGG - Intergenic
988690732 5:33569309-33569331 TTAGGCTGCTCAGGGAACAGGGG - Intronic
989449464 5:41569961-41569983 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
989725271 5:44579646-44579668 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
989797945 5:45498884-45498906 TTAGGCTGCTTGGGGGTCAGGGG + Intronic
989862081 5:46389908-46389930 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
989946044 5:50230805-50230827 TTAGGCTGCTTGGTTTTCAGGGG - Intergenic
990030332 5:51251447-51251469 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
990191908 5:53268700-53268722 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
991102060 5:62804273-62804295 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
991402062 5:66262287-66262309 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
991451054 5:66750986-66751008 TTAGGCTGCTTGGGGGTCAGGGG - Intronic
992329034 5:75696400-75696422 TTAGGCTGCTCGGAGGTCAGGGG - Intronic
992336431 5:75774914-75774936 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
992371396 5:76147621-76147643 TTAGGCTACTTGGAAATCAGAGG + Intronic
992928530 5:81616792-81616814 TTAGGCTGCTCGGGGCACAGGGG - Intronic
993006553 5:82434698-82434720 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
993051695 5:82933143-82933165 TTAGGCTGCTCGGGGCACAGGGG - Intergenic
993524241 5:88944718-88944740 TTAAGCTCCTTGGAAATTAGAGG + Intergenic
993867646 5:93213847-93213869 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
994026938 5:95095363-95095385 TTAAGGTGCTTAGTAAACAGAGG + Intronic
994120569 5:96108525-96108547 TTAGGCTGCTCGGGGATCAGGGG + Intergenic
994224782 5:97239700-97239722 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
994261464 5:97663893-97663915 TTATGTGGCCTGGAAAACAGAGG + Intergenic
994274134 5:97815217-97815239 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
994492396 5:100463572-100463594 TTAGGCTGCTTGGGGGTCAGAGG + Intergenic
994623473 5:102190185-102190207 TTAGGCTGCTCGGGGATCAGGGG - Intergenic
994736390 5:103562090-103562112 TTGAGCTTCTTGGAAAACAAGGG - Intronic
994806275 5:104451681-104451703 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
995741637 5:115362096-115362118 TTAAGCTTCTTTGAAATCAGTGG + Intergenic
996085335 5:119299536-119299558 TTAGGCTGCTTGGGGGTCAGGGG + Intronic
996130915 5:119780065-119780087 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
996231113 5:121064942-121064964 TTAGGCTGCTCGGGGATCAGGGG - Intergenic
997371695 5:133365581-133365603 TTAGGCTCATGGGAAACCAGAGG - Intronic
999091883 5:148942964-148942986 TTAGGCTGCTTGGGGGTCAGGGG - Intronic
999352853 5:150893331-150893353 TTAGACTTCTTATAAAACAGTGG - Intronic
999605097 5:153305860-153305882 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
999646658 5:153723958-153723980 TTAGGCTGCTTGGGGGTCAGGGG - Intronic
999918706 5:156293188-156293210 TTCAGCTGTTTGGAAAACTGAGG - Intronic
1000431689 5:161160059-161160081 TAAGGCTGCTCAGAAAACACAGG - Intergenic
1001189991 5:169620758-169620780 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
1002436590 5:179235461-179235483 CCAGGCTGCATGGAAATCAGAGG + Intronic
1003448946 6:6212369-6212391 TTAGGCTGCTTGGGGGTCAGGGG - Intronic
1003457816 6:6300050-6300072 TTAGGCTGCTTGGGGGTCAGGGG + Intronic
1005292330 6:24392077-24392099 TTAGGCTGGTTGTAATAAAGGGG - Intergenic
1007137223 6:39533774-39533796 TTAGGCTGCTCGGGAGTCAGGGG - Intronic
1008172093 6:48220486-48220508 ATAGGCTGCTTGGAAGAGAATGG - Intergenic
1008801046 6:55368743-55368765 TTAGGCTGCTTGGGGGTCAGGGG + Intronic
1009060690 6:58394494-58394516 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
1010263275 6:73840711-73840733 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
1010679654 6:78783833-78783855 TTAGGCTACTTGGGGATCAGGGG - Intergenic
1010854459 6:80820922-80820944 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
1010901591 6:81434054-81434076 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
1010983359 6:82394719-82394741 TTAGGCTGCTCGGGGATCAGGGG + Intergenic
1010998380 6:82559104-82559126 TTAGGCTGCTCGGGGATCAGGGG - Intergenic
1011364848 6:86570278-86570300 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
1011538733 6:88407201-88407223 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
1012407020 6:98911393-98911415 TTAGGCTGCTTGGGGGTCAGGGG - Intronic
1012434932 6:99204987-99205009 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
1012495064 6:99824281-99824303 TTAGGCTGCTCGGGAGTCAGGGG - Intergenic
1013690172 6:112632610-112632632 TTAGGCTGCTCGGGGATCAGGGG + Intergenic
1014135069 6:117879534-117879556 TTCAGCTGCTTGGAAAGCTGAGG - Intergenic
1014185281 6:118427510-118427532 TTAGGCTGCTTGGTGGTCAGGGG - Intergenic
1014877061 6:126674257-126674279 TTAGGCTGCTCGGGGATCAGGGG - Intergenic
1015388736 6:132655924-132655946 TTGAGCAGCTTGAAAAACAGAGG + Intergenic
1015677899 6:135770786-135770808 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
1015850876 6:137570545-137570567 TTAGGCTGCTTGCCAAACTTGGG - Intergenic
1018381808 6:163264685-163264707 TTCCGCTGGTTGGAAAATAGGGG + Intronic
1019899280 7:4007332-4007354 GGTGGCTGCTTGGAAAAGAGGGG + Intronic
1019969405 7:4528049-4528071 TCAGGTTGCTTGGTCAACAGAGG + Intergenic
1020536442 7:9404064-9404086 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
1021082743 7:16383421-16383443 TTAGGCTGCTTGGGGGTCAGGGG + Intronic
1021618691 7:22529000-22529022 TTAGGCTGCTTGGGGGTCAGGGG - Intronic
1021701308 7:23321763-23321785 TTAGGCTGCTTGGGGGTCAGGGG - Intronic
1022576889 7:31506502-31506524 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
1022893298 7:34723142-34723164 CTAGGCTGCTTGGCAGAAAGGGG + Intronic
1022911942 7:34906942-34906964 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
1023361886 7:39425752-39425774 TAAGAATGCTTGAAAAACAGAGG - Intronic
1025272750 7:57540286-57540308 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
1028053956 7:86220733-86220755 TGTGGCTGTTTGGACAACAGGGG - Intergenic
1028117025 7:87009742-87009764 TTAGCCTGCTTGACAACCAGTGG - Intronic
1028507946 7:91590354-91590376 TTAGGCTGCTTGGAGGTCAGGGG - Intergenic
1028686168 7:93591045-93591067 TTAGGCTGCTTGGGGATCAGGGG + Intergenic
1028886584 7:95941227-95941249 TTAGGCTGCTTGGGGGTCAGGGG + Intronic
1029011147 7:97263488-97263510 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
1029922202 7:104277236-104277258 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
1029922807 7:104283630-104283652 TTAGGATGCTTGGGATAAAGGGG + Intergenic
1030505739 7:110419977-110419999 ATAGGCTACTTGGAAAACACAGG - Intergenic
1030531060 7:110712311-110712333 TTAGGCTGCTTGGGGGTCAGGGG + Intronic
1030905153 7:115173062-115173084 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
1031579145 7:123450487-123450509 TTAGGCTGCTCGGGAGTCAGGGG + Intergenic
1031848196 7:126831132-126831154 TTAGGCTGCTTGGGGGTCAGGGG + Intronic
1032312843 7:130804132-130804154 TTGGGTTGCTGGGAATACAGTGG + Intergenic
1032998552 7:137477170-137477192 TTAGGCAGCAGGGAACACAGTGG - Intronic
1033236559 7:139642502-139642524 CAAGCCTGCTGGGAAAACAGGGG + Intronic
1033844745 7:145418387-145418409 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
1033962263 7:146929151-146929173 TTAGGCTGCTCGGAGGTCAGGGG - Intronic
1035791213 8:2307266-2307288 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
1035801592 8:2414439-2414461 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
1036918532 8:12829587-12829609 TTAGGCTTATAGCAAAACAGAGG + Intergenic
1037146724 8:15581619-15581641 TTAGGCTGCTTGGGGGTCAGGGG + Intronic
1037193719 8:16160434-16160456 TTAGAGTGCCTGGAAAATAGTGG - Intronic
1037230366 8:16651242-16651264 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
1039127106 8:34215636-34215658 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
1039300143 8:36200675-36200697 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
1039350165 8:36755432-36755454 TTAGCCTGCTGGGATCACAGAGG + Intergenic
1040062251 8:43114039-43114061 TTAGGCTGCTTGGGGGTCAGGGG + Intronic
1040078619 8:43265874-43265896 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
1040318835 8:46279308-46279330 TCAGGCTGCTTGCAAAACGCAGG + Intergenic
1041161604 8:55050552-55050574 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
1041371311 8:57163932-57163954 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
1041613829 8:59882555-59882577 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
1041637593 8:60161068-60161090 TTAGGCTGCTCGGGAGTCAGGGG - Intergenic
1041828012 8:62120013-62120035 TTAGGCTGCTTTAAACACAATGG - Intergenic
1041874426 8:62671588-62671610 TTATACTACTTGGAAAACAAAGG - Intronic
1041885336 8:62801331-62801353 TTAGGCTGCTTGGGGGTCAGGGG - Intronic
1042087155 8:65121341-65121363 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
1042434171 8:68744074-68744096 TTAGGCTGCTTGGGGGTCAGGGG - Intronic
1042610699 8:70597262-70597284 TTAAGAAGCTTGGAAAACACTGG + Intronic
1042750438 8:72152745-72152767 TTAGGCTGCTCGGGGGACAGGGG + Intergenic
1042805106 8:72762748-72762770 TTAGGCTTCTTGGAACAGATCGG - Intronic
1043241583 8:77941214-77941236 TTAGGCTGCTTGGCAGTCAGGGG - Intergenic
1043380815 8:79700255-79700277 TCTAGCTGCCTGGAAAACAGAGG + Intergenic
1044609504 8:94078175-94078197 TTTTTCTGCTTGGAAAATAGGGG - Intergenic
1044968282 8:97595004-97595026 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
1045263404 8:100597105-100597127 TTATGGTGCTTGGTACACAGTGG + Intronic
1045403789 8:101844962-101844984 TTGGGATGCTGGGAACACAGTGG - Intronic
1045433230 8:102133454-102133476 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
1045450304 8:102317652-102317674 TTAGGCTGCTTGGGGGTCAGGGG - Intronic
1045808872 8:106198494-106198516 TTAAGCTGCTGGGTCAACAGAGG - Intergenic
1046968415 8:120193475-120193497 TTAGGCTGCTTGGGGGTCAGCGG + Intronic
1047046219 8:121056111-121056133 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
1047077336 8:121418584-121418606 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
1047149572 8:122245118-122245140 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
1047656745 8:126985735-126985757 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
1047837989 8:128715063-128715085 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
1047841708 8:128760553-128760575 TTAGGCTGCTCGGGAGTCAGGGG - Intergenic
1049615475 8:143573993-143574015 TCAGGCTGCTTCGACAAGAGAGG + Intergenic
1050048493 9:1574321-1574343 TTAGGCTGCTTGGGGCTCAGGGG + Intergenic
1050065009 9:1750239-1750261 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
1051479140 9:17540264-17540286 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
1051584443 9:18711937-18711959 TTAGGCTGCTTGGGGGTCAGGGG - Intronic
1051899574 9:22024562-22024584 TAATGCTGCATGGAGAACAGAGG - Intronic
1052281807 9:26741711-26741733 TTAGGGTCCCTGGAACACAGAGG - Intergenic
1052612231 9:30790482-30790504 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
1053700040 9:40681107-40681129 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
1054410113 9:64804658-64804680 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
1055860767 9:80746968-80746990 TTAGGCTGCTTGGGAGTCAGGGG + Intergenic
1056042251 9:82680421-82680443 GCAGGCTGGATGGAAAACAGGGG + Intergenic
1056049854 9:82757141-82757163 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
1056077292 9:83054846-83054868 TTAGGCTGCTTGGGGGTCAGGGG + Intronic
1056235237 9:84587860-84587882 TGTGGCAGCTTGGAAACCAGGGG + Intergenic
1057322302 9:94025769-94025791 TTAGGCTGCTCGGGAGTCAGGGG + Intergenic
1057682811 9:97205855-97205877 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
1059687624 9:116652512-116652534 TTGGGCTGCATGGAAAATATAGG - Intronic
1060147801 9:121267715-121267737 ATAGGCTGCATGCAAAGCAGGGG - Intronic
1061312717 9:129774713-129774735 GTTGGCTGGTTGGAAACCAGAGG + Intergenic
1061537725 9:131259950-131259972 TAAGGCTGCTGGGAAGAGAGGGG + Exonic
1062291633 9:135797866-135797888 GGAGGCTGCTTGGGAAGCAGAGG - Intergenic
1186968075 X:14809895-14809917 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
1188006450 X:25018978-25019000 CTGGTCTGCTTGGAAAACAATGG + Intergenic
1188263341 X:28042072-28042094 CTGGGTTGCCTGGAAAACAGAGG - Intergenic
1188648930 X:32606018-32606040 TTAGGTTGCTTGTAAGACAAAGG - Intronic
1189265961 X:39716217-39716239 TTAGGGGGCTTGCAAAACATGGG + Intergenic
1189539427 X:41970926-41970948 ATAAGCTGCTTGGAAAAGAAAGG + Intergenic
1189713280 X:43837916-43837938 TGAGGATGCTGGAAAAACAGAGG + Intronic
1190421413 X:50288268-50288290 TTAAGCAGCTTTTAAAACAGCGG - Intronic
1190602329 X:52106024-52106046 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
1191092369 X:56636714-56636736 TTAGGCTGCTCGGGAGTCAGGGG - Intergenic
1191194816 X:57709229-57709251 TTAGGCTGCTTGGTTGTCAGGGG - Intergenic
1191656241 X:63602496-63602518 TTAGGCTGCTCGGAGGTCAGGGG + Intergenic
1191680960 X:63839344-63839366 TTAGGCTGCTTGGGGGCCAGGGG - Intergenic
1191727990 X:64301867-64301889 TTAGGCTGCTTGGGGGTCAGGGG + Intronic
1191855218 X:65620009-65620031 TTAGGCTGCTCGGGGATCAGGGG + Intronic
1192015608 X:67326742-67326764 TTAGGCTGCTCGGGAGTCAGGGG + Intergenic
1192065648 X:67881898-67881920 TTAAACTGCTTGCAAAACAAGGG - Intergenic
1192096524 X:68217619-68217641 TTAGGCTGCTTGGGGGTCAGGGG - Intronic
1192210875 X:69126991-69127013 TGAGGCTGCGTGGAAAGCAGGGG + Intergenic
1192383365 X:70639609-70639631 TTAGGCTGCTTGGGGGTCAGGGG - Intronic
1192668837 X:73117613-73117635 TTAGGCTGCTTGGGGATCAGGGG - Intergenic
1192692762 X:73381686-73381708 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
1192696230 X:73418921-73418943 TTAGGTTGCTGGGAAGAGAGGGG + Intergenic
1192876284 X:75232626-75232648 TTAGGCTGCTTGGGGATCAGGGG - Intergenic
1193244328 X:79211118-79211140 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
1193304050 X:79927502-79927524 TTAGGCTGCTCGGAGGTCAGGGG - Intergenic
1194028803 X:88786843-88786865 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
1194068715 X:89293332-89293354 TTAGGCTGCTTGGGGGTCAGAGG - Intergenic
1194239695 X:91429490-91429512 CTAGTCTGCTTTGAAAACATGGG + Intergenic
1194255389 X:91627802-91627824 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
1194303598 X:92215767-92215789 TTAGGCTGCTCGGGAGTCAGGGG - Intronic
1194570454 X:95549185-95549207 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
1194836840 X:98692801-98692823 TTAGGCTGCTCGGGAGTCAGGGG + Intergenic
1195249112 X:103025891-103025913 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
1195639394 X:107156470-107156492 TTAGGCTGCTCGGGGATCAGGGG - Intronic
1196511728 X:116519911-116519933 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
1196638539 X:118032431-118032453 TTAGGCTGCTTGGGGGTCAGGGG - Intronic
1197036294 X:121878059-121878081 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
1197417280 X:126190525-126190547 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
1197829727 X:130628746-130628768 TTAGGCTAAGTGGAAATCAGGGG - Intronic
1197841764 X:130755717-130755739 TTTGGTTGCTTGTAACACAGAGG - Intronic
1197893256 X:131286311-131286333 TTGGGCTGATTGGGAATCAGAGG - Intronic
1198575689 X:138008161-138008183 TTAGGCAGCTCTGAAAACTGTGG - Intergenic
1198689061 X:139260237-139260259 TTAGGCTACTTGGGGATCAGGGG - Intergenic
1200357385 X:155565994-155566016 TTAGGTTGCTTTGAAAACCTAGG + Intronic
1200565455 Y:4759901-4759923 TTGGGTTGCTTGTAACACAGAGG - Intergenic
1200574120 Y:4867063-4867085 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
1200583091 Y:4973946-4973968 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
1200722861 Y:6627487-6627509 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
1200772059 Y:7135304-7135326 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
1201053687 Y:9967034-9967056 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
1201258656 Y:12135560-12135582 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
1201450152 Y:14102840-14102862 TTAGGCTGCTCGGGGATCAGGGG - Intergenic
1201545564 Y:15158330-15158352 TTAGGCTGCTTGGGGGTCAGTGG + Intergenic
1201600887 Y:15727622-15727644 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
1201779885 Y:17709060-17709082 TTAGGCTGCTTGGGGATCAGGGG - Intergenic
1201821670 Y:18196932-18196954 TTAGGCTGCTTGGGGATCAGGGG + Intergenic
1201936697 Y:19418298-19418320 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
1201976120 Y:19850803-19850825 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
1202014458 Y:20385983-20386005 TTAGGCTGCTCGGAGGTCAGGGG + Intergenic
1202072905 Y:21011213-21011235 TTAGGCTGCTCGGGAGTCAGGGG + Intergenic
1202077605 Y:21053067-21053089 TTAGGCTGCTCGGGAGTCAGGGG + Intergenic
1202327350 Y:23705305-23705327 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic
1202543420 Y:25964747-25964769 TTAGGCTGCTTGGGGGTCAGGGG + Intergenic
1202577233 Y:26340437-26340459 TTAGGCTGCTTGGGGGTCAGGGG - Intergenic