ID: 1138064292

View in Genome Browser
Species Human (GRCh38)
Location 16:53924595-53924617
Sequence TAGACTATGAAGGGCGGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 129}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138064284_1138064292 -5 Left 1138064284 16:53924577-53924599 CCTGCTTTCCTGGGTGAGTAGAC 0: 1
1: 0
2: 2
3: 9
4: 122
Right 1138064292 16:53924595-53924617 TAGACTATGAAGGGCGGGGGAGG 0: 1
1: 0
2: 0
3: 8
4: 129
1138064281_1138064292 20 Left 1138064281 16:53924552-53924574 CCTTTCAAGACAGTGGAGTTTAT 0: 1
1: 0
2: 3
3: 18
4: 162
Right 1138064292 16:53924595-53924617 TAGACTATGAAGGGCGGGGGAGG 0: 1
1: 0
2: 0
3: 8
4: 129
1138064280_1138064292 24 Left 1138064280 16:53924548-53924570 CCTTCCTTTCAAGACAGTGGAGT 0: 1
1: 1
2: 6
3: 42
4: 308
Right 1138064292 16:53924595-53924617 TAGACTATGAAGGGCGGGGGAGG 0: 1
1: 0
2: 0
3: 8
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138064292 Original CRISPR TAGACTATGAAGGGCGGGGG AGG Intronic
904232032 1:29082596-29082618 TACACTATGAAGGGTAGGGGTGG - Intronic
906290993 1:44619072-44619094 TGGAGGTTGAAGGGCGGGGGTGG + Intronic
908287319 1:62621162-62621184 TAGACGAGGGAGGGAGGGGGAGG + Intronic
908402344 1:63783194-63783216 TAGCATATGAAGGGTGGAGGAGG + Intronic
916464041 1:165055816-165055838 TAGACTTTTAAGGTCGGGCGCGG + Intergenic
917679717 1:177353495-177353517 TAGACCTAGAAGGGCAGGGGAGG + Intergenic
918165210 1:181938338-181938360 TAGTCTATGTGGGGGGGGGGGGG - Intergenic
921193759 1:212732582-212732604 AAGACTATGTAGGCCGGGTGCGG - Intronic
1064613558 10:17128744-17128766 TACACTAGGAAGGGGGAGGGAGG + Intronic
1069556105 10:69399573-69399595 AAGACTTGGAAGGGCGGGAGCGG + Intronic
1069919692 10:71808915-71808937 TAGACCTTGAAGGGTGGCGGAGG - Intronic
1070840505 10:79484127-79484149 CAGAATATGAAGGCTGGGGGTGG + Intergenic
1071512384 10:86270327-86270349 GAGAGAATGAAGGGTGGGGGTGG - Intronic
1072727264 10:97822204-97822226 CAGGCTATGAAGGGGTGGGGTGG + Intergenic
1075158420 10:120001125-120001147 TTCACAATTAAGGGCGGGGGTGG - Intergenic
1075987652 10:126801401-126801423 GAGACTCAGAAGGGTGGGGGTGG - Intergenic
1078062511 11:8057074-8057096 TAGGCTCTGGAGGGCTGGGGAGG + Intronic
1079432329 11:20404520-20404542 AAAACTATGAAGGGCCGGCGTGG - Intronic
1083723781 11:64618023-64618045 TAGAGGATGAAGGGTGGAGGAGG - Intronic
1085611357 11:77953348-77953370 TATACTATGTAGGGTGGGTGGGG - Intronic
1086415895 11:86588710-86588732 TGAAGTATGAAGGGCAGGGGAGG + Intronic
1087093868 11:94302032-94302054 GAGACTCAGAAGGGCGGGAGGGG + Intergenic
1096134802 12:49190570-49190592 CAGGCTAAGAAGGGCGTGGGAGG + Intronic
1096182713 12:49559419-49559441 CAGCCTAAGAAGGGCGGGGATGG + Intronic
1097784158 12:63740427-63740449 TACACGACAAAGGGCGGGGGTGG - Intergenic
1101058537 12:100946343-100946365 TAGACTGTGAGGGGTGGAGGTGG + Intronic
1105564317 13:21529194-21529216 TTGAATATGAAGGGTGGGAGGGG + Intronic
1111947357 13:94679834-94679856 TATATTATGAAGGGTGGAGGAGG - Intergenic
1117249226 14:53918848-53918870 AAGACTTTTAGGGGCGGGGGTGG - Intergenic
1117270990 14:54143305-54143327 TAGACTAGGAAGGGAGTGAGTGG - Intergenic
1117548782 14:56813264-56813286 CAGACAAGGAAGGGGGGGGGGGG + Intergenic
1117845421 14:59906561-59906583 AAGAATATGAAGGGAGGTGGAGG - Intergenic
1119205752 14:72792233-72792255 GAGACTCTGAAGGGGAGGGGAGG + Intronic
1119773595 14:77235917-77235939 GAGACTGTGATGGGTGGGGGAGG + Intronic
1119773773 14:77236422-77236444 GAGACTGTGATGGGTGGGGGTGG + Intronic
1119941606 14:78647287-78647309 TAGAACATGAAGGGCAGGGGCGG - Intronic
1121597875 14:95179713-95179735 GAGGCAGTGAAGGGCGGGGGCGG - Intergenic
1123926149 15:25113628-25113650 TAAACTAGAAAGGCCGGGGGTGG + Intergenic
1125488278 15:40127457-40127479 TATACTATGAAGGTTGGGAGAGG + Intergenic
1126434392 15:48621262-48621284 TACAGTATAAAGGGAGGGGGAGG + Intronic
1127443797 15:59039252-59039274 TAGAATATCAAGGCCGGGAGTGG - Intronic
1127763906 15:62166102-62166124 CAGAAAATGAAGGTCGGGGGTGG - Intergenic
1130297607 15:82658228-82658250 TAGACTTTGCAGGGGGCGGGAGG + Intergenic
1131188555 15:90294867-90294889 TAGGCCAAGAAGGGTGGGGGTGG + Intronic
1131288870 15:91087294-91087316 TAGACTCTAAGGGGCAGGGGTGG - Intergenic
1132432415 15:101772526-101772548 TGGACCAAGAAGGGCAGGGGTGG - Intergenic
1132821285 16:1872455-1872477 AATATTATGAAGGGCGGGCGCGG + Intronic
1135511520 16:23088624-23088646 TAGACTCAGAAGGGTGGGGAGGG - Intronic
1136605582 16:31331294-31331316 GAGAGGATGAAGGGAGGGGGTGG - Intronic
1138064292 16:53924595-53924617 TAGACTATGAAGGGCGGGGGAGG + Intronic
1139505950 16:67398186-67398208 TAGAGGATGAAGGGTGGGAGGGG - Intronic
1141720910 16:85754749-85754771 GAGGCTATAAAGGGTGGGGGTGG + Intergenic
1142574182 17:895316-895338 TGAACTATGAAGGGAAGGGGTGG - Intronic
1151182925 17:72342818-72342840 TAGGCTAAGAGGGGCGGGGGCGG - Intergenic
1152477449 17:80527291-80527313 TGGGCTATGATGGGCGGTGGCGG + Intergenic
1158991813 18:62876353-62876375 TACACTTTGAAGGGTGGGGTAGG - Intronic
1161632801 19:5367322-5367344 TAGACACTGAAGGGATGGGGGGG + Intergenic
1163261528 19:16193490-16193512 TAGGCTATGTAGGCCGGGCGTGG - Intergenic
1163551917 19:17970053-17970075 TAGACTGTGAAGTGCTGGGCCGG + Intronic
1166338847 19:42125381-42125403 TAGACTGTTGAGGGTGGGGGTGG + Intronic
1167647138 19:50711912-50711934 CAGGCCATGAAGGGCTGGGGTGG - Intronic
1168148109 19:54430653-54430675 TGGACTCTGAAGGGAGGGGGCGG + Intronic
925061741 2:896913-896935 TAGACTGTGCAGGGTTGGGGAGG - Intergenic
925716217 2:6786485-6786507 TAGATTATGAAGGGAGTGAGGGG - Intergenic
935288553 2:101588696-101588718 TAGACTCTGAAGGCAGGGGTTGG - Intergenic
935476640 2:103530694-103530716 TGGTCTATTAAGGGAGGGGGTGG + Intergenic
939725494 2:145715823-145715845 TAGATGATGGAGGGCGGGGCAGG + Intergenic
940507153 2:154570327-154570349 TAGTCTATTAAGGCCGGGCGCGG - Intergenic
1169316132 20:4592508-4592530 TAGGCTATGAGGGCAGGGGGTGG + Intergenic
1170347743 20:15405724-15405746 CTGACTATGAAGGTCGGGGTAGG - Intronic
1170743914 20:19081526-19081548 TAGACTGTGGTGGGCGGTGGGGG - Intergenic
1172025640 20:31946423-31946445 TGGACTTTGAAGGGCAGGGATGG - Intronic
1174583083 20:51586552-51586574 AAGACAATGAAGGCCGGGTGCGG + Intergenic
1183156700 22:36081315-36081337 TGGGCTATGAAGAGCGGGGTTGG + Intergenic
1183956011 22:41381360-41381382 CAGCCAATGGAGGGCGGGGGCGG - Intronic
1185191394 22:49438703-49438725 CAGAAGATGAAGGGCGAGGGAGG - Intronic
950271137 3:11616141-11616163 TGGAGTCTGAGGGGCGGGGGAGG - Intronic
957048530 3:75394784-75394806 TGGACTCTGAAGGGAGGAGGTGG + Intergenic
958501430 3:94914693-94914715 TAGACTATGTGGGCCGGGCGCGG + Intergenic
959904931 3:111700826-111700848 CAGACTGTGTAGGGCGGGGCGGG + Intronic
962108248 3:132416089-132416111 TAGAGTAGGAAGGGAGGAGGAGG - Intergenic
969438635 4:7203832-7203854 TAGACTGTGAGTGGCGGGGGTGG - Intronic
969694315 4:8726056-8726078 GAGACTTTGAAGGGCGGGGAAGG - Intergenic
972521976 4:39867400-39867422 TAAACTATACAGGCCGGGGGTGG + Intronic
972637099 4:40893996-40894018 TAGATTATGAGGGCCGGGCGCGG + Intronic
973282658 4:48376155-48376177 TAGAATATGAAGGAAGGGGCTGG + Intronic
976009597 4:80471557-80471579 GAGACTCAGCAGGGCGGGGGTGG + Intronic
977760623 4:100732313-100732335 TAGACAATGCAGGGAGGTGGAGG - Intronic
977932262 4:102761452-102761474 TACTCTTTGAAGGGCGGGGTAGG - Intergenic
980859873 4:138486342-138486364 TGGACTATGAGGGGCTGGAGTGG - Intergenic
984697019 4:182789310-182789332 TAGATTATGACGGACAGGGGAGG + Exonic
986178974 5:5376032-5376054 TTGGCTATGAAGGGCTTGGGTGG + Intergenic
991193016 5:63897669-63897691 GATACCATGAAGGGCTGGGGTGG - Intergenic
995957331 5:117793821-117793843 CAGAGTATGAAGGGTGAGGGAGG - Intergenic
996388558 5:122934857-122934879 TTCACAATGAAGGGTGGGGGAGG - Intronic
998596228 5:143533421-143533443 TGGACTCTCAAGGGCAGGGGAGG + Intergenic
1000787910 5:165569678-165569700 TAAACTGTGCAGGGCTGGGGAGG + Intergenic
1001653603 5:173331582-173331604 TAGACCATGAAGGATGGGGGAGG + Intergenic
1005375836 6:25181349-25181371 TACACTGTGCTGGGCGGGGGTGG - Intergenic
1010048065 6:71470520-71470542 GAGACTAGGAAGGGTGGGGAGGG - Intergenic
1010606058 6:77890645-77890667 GAGATTATGAGGGGCTGGGGTGG + Intronic
1019795270 7:3043893-3043915 TAGGCTGGGAGGGGCGGGGGAGG + Exonic
1021112746 7:16714190-16714212 GAGACTACGAAAGGCAGGGGTGG - Intergenic
1022402085 7:30048830-30048852 TAGACTGTGAGGGGAGGGGGAGG + Intronic
1022715238 7:32892176-32892198 AAGAGCAGGAAGGGCGGGGGCGG + Intronic
1022835722 7:34112202-34112224 TAGACAATGAAGGCCAGGCGCGG + Intronic
1028863626 7:95682444-95682466 AAGACTATGAAGGGTGGAAGAGG + Intergenic
1035605728 8:928966-928988 TAGAGTGGGAATGGCGGGGGGGG - Intergenic
1036082626 8:5574125-5574147 TAGACTATGAATGGGAGTGGAGG + Intergenic
1038638313 8:29304530-29304552 GAGCCCATGAAGGGCGTGGGAGG - Intergenic
1039029282 8:33292224-33292246 TAGACTATAAAGGGCAAGTGTGG - Intergenic
1039323617 8:36461070-36461092 TAGACTAGGAGGTGGGGGGGGGG - Intergenic
1041536629 8:58933556-58933578 TAAACTTTGAAGGGGGGTGGGGG + Intronic
1042156707 8:65851797-65851819 AAGACAATGATGGCCGGGGGTGG + Intergenic
1042346118 8:67730011-67730033 TAGCAGATGTAGGGCGGGGGAGG + Intronic
1045962650 8:107986818-107986840 TAGACTACCTATGGCGGGGGTGG - Intronic
1047827524 8:128593758-128593780 GAGACTATGAAGGTTGTGGGGGG + Intergenic
1051776314 9:20637996-20638018 GACACTAGGAAGGGTGGGGGTGG + Intergenic
1053578897 9:39382421-39382443 TAGACAGTGAGGGGAGGGGGTGG + Intergenic
1053843412 9:42210496-42210518 TAGACAGTGAGGGGAGGGGGTGG + Intergenic
1054100480 9:60941225-60941247 TAGACAGTGAGGGGAGGGGGTGG + Intergenic
1054121877 9:61216850-61216872 TAGACAGTGAGGGGAGGGGGTGG + Intergenic
1054585867 9:66965661-66965683 TAGACAGTGAGGGGAGGGGGTGG - Intergenic
1055699884 9:78932363-78932385 GAGACTAAGAAGGGTGGGGTGGG + Intergenic
1058347193 9:103978429-103978451 TAGTCCATGAAGGTAGGGGGTGG + Intergenic
1058596504 9:106621325-106621347 CAGACTATGGAGGTTGGGGGGGG - Intergenic
1060171996 9:121469430-121469452 TAGACGATGAAAGGCATGGGAGG + Intergenic
1061048743 9:128181750-128181772 CAGACCAGGAAAGGCGGGGGGGG + Intronic
1061700013 9:132408909-132408931 TAGATTTTGAAGGGAAGGGGAGG - Intergenic
1062306389 9:135909082-135909104 CAGACTAGGAAGGGCTGAGGAGG + Intergenic
1188020123 X:25148046-25148068 GAGACTAGGAAGGGCAGTGGCGG - Intergenic
1189391417 X:40580113-40580135 AAGACTATGAACTGCGGGAGGGG + Intergenic
1190052656 X:47162583-47162605 TAGAGTATGGAGGCCGGGTGTGG + Intronic
1192594074 X:72387937-72387959 TAAACTATGGAGGGGAGGGGTGG + Intronic
1194837793 X:98702588-98702610 TAGACTGGGAAGGGTGGGGAGGG - Intergenic
1196776764 X:119345211-119345233 TAGACTGTGAAGGGGCTGGGAGG - Intergenic
1196804654 X:119573982-119574004 TTGACTATGACGGGGGGGCGGGG - Intergenic
1201155439 Y:11128358-11128380 TGTACTATGAAGGGTGTGGGGGG - Intergenic