ID: 1138066741

View in Genome Browser
Species Human (GRCh38)
Location 16:53949300-53949322
Sequence GTCTCACCACTCCACACTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138066740_1138066741 -7 Left 1138066740 16:53949284-53949306 CCAGAATCATCTTTTAGTCTCAC 0: 1
1: 0
2: 1
3: 15
4: 208
Right 1138066741 16:53949300-53949322 GTCTCACCACTCCACACTGATGG 0: 1
1: 0
2: 1
3: 9
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138066741 Original CRISPR GTCTCACCACTCCACACTGA TGG Intronic
905975029 1:42168438-42168460 GTGACATCACTCCACACTGTGGG + Intergenic
906942231 1:50265431-50265453 GCCTCATCTCTCCACCCTGATGG + Intergenic
911940926 1:104046658-104046680 GTCTGACCACTCCACATATAGGG - Intergenic
911942830 1:104069331-104069353 GCCTCACCACTGCAGGCTGAAGG - Intergenic
913597462 1:120392698-120392720 GTCCCACCATTGCACACTGAGGG - Intergenic
914089868 1:144486616-144486638 GTCCCACCATTGCACACTGAGGG + Intergenic
914308742 1:146447600-146447622 GTCCCACCATTGCACACTGAGGG - Intergenic
914512563 1:148346714-148346736 GTCCCACCATTGCACACAGAGGG + Intergenic
914593367 1:149125531-149125553 GTCCCACCATTGCACACTGAGGG + Intergenic
916511032 1:165472589-165472611 GTCTCACAACCACCCACTGAGGG + Intergenic
916712890 1:167427553-167427575 GTCCCACGAAACCACACTGAGGG - Intergenic
919560999 1:199118200-199118222 GGCTAAACACTCCACACTCAGGG - Intergenic
919881813 1:201905989-201906011 GTATCACCAGGCCACATTGAGGG - Intronic
920346742 1:205310745-205310767 GTCTCCCCACTCTTCCCTGAGGG + Intronic
921347694 1:214203825-214203847 GACTCACCATTCCACACGGCTGG + Intergenic
921491838 1:215786745-215786767 GTCTCACAATTCCACAGGGAAGG - Exonic
923692769 1:236212039-236212061 ATCTCAGAACTCCACACGGAAGG - Intronic
1062786591 10:270192-270214 GACTCCCAACTCCACACTTAGGG + Intergenic
1063386297 10:5618277-5618299 GGCTCAGCATTCCACTCTGAAGG + Intergenic
1073920493 10:108452628-108452650 GTACAACCACACCACACTGAAGG + Intergenic
1076352876 10:129830951-129830973 CTCCCAACACTCCACATTGATGG - Intergenic
1085252488 11:75152844-75152866 GGCTCACCACACTACTCTGAGGG + Intronic
1086499480 11:87437358-87437380 TTCTCACCACTGTATACTGAAGG + Intergenic
1088938715 11:114431945-114431967 TTCTAACCACTCCTCACTAAAGG - Intronic
1092542132 12:9426626-9426648 GTCTCATCACTCACCATTGAGGG - Intergenic
1093464414 12:19435485-19435507 GTCTCAGCTCTCCACAGTGCTGG + Intronic
1094416221 12:30217884-30217906 GTCTCCTCACTCCACATAGAAGG - Intergenic
1094510880 12:31095807-31095829 GTCTCATCACTCACCATTGAGGG + Intronic
1097909819 12:64957915-64957937 TTCTCACCCTTCCACATTGAGGG + Intergenic
1098444600 12:70553307-70553329 GTCTCACAACTCCAGAGTGTTGG + Intronic
1098723942 12:73938667-73938689 CCCTCAGAACTCCACACTGATGG + Intergenic
1100212576 12:92412523-92412545 GTCCCACCACTGCCCACTGTGGG + Intergenic
1100391112 12:94147387-94147409 GTCTCACCACCTCACCCAGAGGG - Intergenic
1104024828 12:125018107-125018129 ATCTCACTTCTCCACACTGAGGG + Intronic
1104204188 12:126620579-126620601 GTCTCATCAGTTAACACTGAAGG - Intergenic
1106638250 13:31554355-31554377 GTCTTACCACTGCATAGTGAGGG - Intergenic
1108710508 13:53028264-53028286 GTCTAACAACCCCACTCTGAAGG - Intergenic
1109369999 13:61411584-61411606 GCCTCTCCACTCCACAGTCATGG - Exonic
1110946526 13:81427450-81427472 GTCACTCCACTCCAGTCTGAGGG + Intergenic
1119646853 14:76354442-76354464 ATCTCACCATTGCACTCTGAAGG + Intronic
1121212020 14:92214247-92214269 GTCTCACCTCTGCACGCTAAAGG + Intergenic
1124288298 15:28424638-28424660 GTCACACCACTCCAGCCTGGGGG - Intergenic
1124294925 15:28492676-28492698 GTCACACCACTCCAGCCTGGGGG + Intergenic
1126780408 15:52134774-52134796 GTCTCACCACTGCCTCCTGACGG + Intronic
1129205198 15:74033306-74033328 GTCTCACCACCCCACCTGGATGG + Exonic
1129234825 15:74217762-74217784 GTGTCCCCATGCCACACTGAAGG - Intergenic
1132809267 16:1789831-1789853 GTCTCACCCCTCCTCTTTGAGGG - Intronic
1133229748 16:4360875-4360897 GCCCCACCTCTCCACACTGCTGG + Intronic
1133269173 16:4602261-4602283 GTCCCACCTCCCCACACAGAAGG - Intergenic
1136084092 16:27872212-27872234 GTCTCCTCACTCCAGACTGGGGG - Intronic
1137929677 16:52575164-52575186 ATTTCACCTCTCCACACTGCAGG + Intergenic
1138066741 16:53949300-53949322 GTCTCACCACTCCACACTGATGG + Intronic
1140951259 16:79819970-79819992 CTCACACCACACCAAACTGATGG - Intergenic
1144227835 17:13168305-13168327 ATCACACCACTGCACTCTGATGG + Intergenic
1146442146 17:32906721-32906743 CTCTCCCCACTCCAGACTGAGGG + Intergenic
1147649352 17:42053294-42053316 AGCTCACCTCTCCACACAGACGG - Intronic
1147849280 17:43428719-43428741 ATCTCACCACTGCACTCTGGTGG + Intergenic
1149228238 17:54500285-54500307 ATCACAACAATCCACACTGATGG + Intergenic
1150593778 17:66585659-66585681 GGCTCCCCACTCCACATTGCTGG - Intronic
1152918710 17:83054989-83055011 GTCTCCCCACCCAGCACTGAAGG - Intergenic
1155800763 18:30099884-30099906 GTCTGACCAAACCACACTCAGGG - Intergenic
1157936886 18:51883405-51883427 GCCTCACCACTACAGGCTGAAGG + Intergenic
1158215458 18:55096358-55096380 GTCTCATCACTTAACACTAATGG + Intergenic
1158776810 18:60592926-60592948 GTCTGACCACCCCAGACTGCTGG - Intergenic
1158783839 18:60685223-60685245 GTCTCACCATGCCACACCCAAGG - Intergenic
1159411654 18:68084508-68084530 CTTTCACCACTTCAAACTGAGGG - Intergenic
1161202870 19:3025580-3025602 ATCTCAGCACGCCACACTCAAGG + Intronic
1162030249 19:7914215-7914237 GGCTCCCCACTTAACACTGAAGG - Exonic
1164460414 19:28442944-28442966 CACTCACCCCTCCACACTGTGGG - Intergenic
1166031885 19:40137495-40137517 GTCTCACCTCCCAACACTGTTGG + Intergenic
1168523700 19:57072190-57072212 GTATCACCACTTCACAATGAAGG - Intergenic
926796508 2:16623887-16623909 GTTTCACCAATCCAGGCTGATGG + Exonic
927927166 2:27021928-27021950 GCCTCATCACTCCCTACTGAGGG + Intronic
930611533 2:53549612-53549634 CTCTCACCACTCCTCTTTGATGG - Intronic
931493856 2:62781108-62781130 GTTTCCCCACTCCAGACTGTAGG - Intronic
933416107 2:81988249-81988271 GTCTAAGCACTCCAAACAGAAGG - Intergenic
933747312 2:85580515-85580537 TTCTTACCCCTGCACACTGAGGG - Intronic
934884893 2:98015889-98015911 GTTTCATCCCTGCACACTGATGG - Intergenic
937203151 2:120218673-120218695 GCCTCACCACTGCTAACTGAGGG + Intergenic
938226841 2:129624053-129624075 GTCTCTCCACTCCCCACATATGG + Intergenic
938577986 2:132621409-132621431 GTCTCAGCAGACCACACAGAGGG + Intronic
938743373 2:134253714-134253736 ATCTCATCACTAAACACTGATGG + Intronic
941019374 2:160391634-160391656 GTCTCACCACTTCAGAATTATGG + Intronic
941110254 2:161413978-161414000 GTCTCACCTCTACACATTTAAGG + Intergenic
944920602 2:204409071-204409093 GGCTCACCACTCCACCCACACGG - Intergenic
947195348 2:227559732-227559754 GTCTCTCCACTCAAGAATGAGGG - Intronic
948425939 2:237886585-237886607 GCCTCACCCCTCCACACCCAGGG + Intronic
948649995 2:239436542-239436564 GTCTCACAAATGGACACTGAGGG - Intergenic
948807182 2:240458038-240458060 AGCTCAGGACTCCACACTGACGG - Intronic
1169017788 20:2305757-2305779 GTCACCCCACTCCACAGTGGAGG - Intronic
1176299590 21:5092566-5092588 GTCTCTCGTCTCCACACTGCAGG + Intergenic
1179857436 21:44169381-44169403 GTCTCTCGTCTCCACACTGCAGG - Intergenic
1182306933 22:29376381-29376403 GCCTCATCTCACCACACTGATGG - Intronic
950435413 3:12976383-12976405 GCCTCACCATTCCTCACTCAAGG + Intronic
953799488 3:46011431-46011453 GTCCCTCCAAGCCACACTGATGG + Intergenic
958858689 3:99418939-99418961 CTCTCTCCACTCCAGACTGCTGG + Intergenic
964194968 3:154053057-154053079 GTCGCACCACCCCACTCTCATGG - Intergenic
966359005 3:179114113-179114135 ATCTGACAACTCCAAACTGAGGG + Intergenic
967794598 3:193585846-193585868 GTCTAACCATTCCACTCTCAGGG - Intronic
973744935 4:53954867-53954889 GTTGCACCACTGCACACTGTGGG + Intronic
981088558 4:140708972-140708994 CTCCCACCATTCGACACTGAAGG - Intronic
984388484 4:179096400-179096422 GTATCAACATCCCACACTGAAGG - Intergenic
985823813 5:2178599-2178621 GTGTCAGCTCTGCACACTGATGG + Intergenic
986633087 5:9793617-9793639 GACTCACCACCCCAGACTGCAGG - Intergenic
994562686 5:101396166-101396188 ATGTCCCCACTCCACAATGAGGG + Intergenic
995741720 5:115362968-115362990 TTCTGACTACTCCAAACTGATGG - Intergenic
996872113 5:128203159-128203181 GACTCACTGCTCCACATTGATGG - Intergenic
1000943477 5:167391962-167391984 GTCTCTCCACCCAACACTTAAGG - Intronic
1003133037 6:3412034-3412056 ATCTCAACACTCCACAATGTGGG - Intronic
1003920054 6:10824590-10824612 GTCTCCCCTCTCCATACAGATGG + Intronic
1005030627 6:21505369-21505391 GTATCATCATTCCACAGTGAAGG + Intergenic
1010294126 6:74176456-74176478 GTCTCACCAACCCACATGGAGGG - Intergenic
1011746641 6:90413255-90413277 ATCTCTTCACCCCACACTGAGGG + Intergenic
1014951363 6:127559259-127559281 GACTCACAATTCCACACTGCTGG - Intronic
1016614547 6:146030196-146030218 GTCTCTGCAGTCCACACGGAAGG + Exonic
1021929257 7:25563155-25563177 GCCTCTGCACTCCACACTGTCGG - Intergenic
1022128818 7:27383318-27383340 GTCTCAACACTGCTTACTGATGG + Intergenic
1023563219 7:41497125-41497147 GTCTTAACACTCCACACTGAAGG - Intergenic
1024094994 7:45976244-45976266 GATGCTCCACTCCACACTGATGG - Intergenic
1029237542 7:99133464-99133486 GTGACACCAATCCACACTCAAGG + Intronic
1032728697 7:134616223-134616245 GACTCACCTCTGCACACAGAAGG - Intergenic
1033345568 7:140523258-140523280 GTCTCTCCCTTCCACTCTGAGGG - Intronic
1034496580 7:151427023-151427045 GTGTCACCTCTACACACAGAGGG - Intergenic
1036056967 8:5266085-5266107 GTCCCCACACTCCATACTGATGG - Intergenic
1036584111 8:10107020-10107042 GCCTCATCACTCAGCACTGAGGG - Intronic
1037786266 8:21905190-21905212 GCCTGCCCACTCCACACTGTAGG + Intergenic
1042722535 8:71841758-71841780 GTCTCCCCACTCCACGCTCCGGG - Exonic
1044596817 8:93967740-93967762 GTCTCCCAACAGCACACTGATGG + Intergenic
1044615411 8:94135567-94135589 GTCTCCCAACAGCACACTGATGG + Intronic
1045661419 8:104441681-104441703 GTCTCACCAGGCCACAGTCAAGG - Intronic
1049331286 8:142055374-142055396 GTCTCACAAGGCCACACTCAAGG - Intergenic
1052115941 9:24648778-24648800 GTCTCACCTCTCCCCACTCTTGG + Intergenic
1056563211 9:87750937-87750959 GCCTCACCACTCCATTCTCAGGG - Intergenic
1061601302 9:131671995-131672017 GTTTCTCCACTCCACACTCCAGG - Intronic
1062704662 9:137931033-137931055 GCCTCACCCTTCCACACTGAAGG + Intronic
1189744819 X:44158529-44158551 GTCTCATCACTTCACACTCAGGG + Intronic
1194030803 X:88811401-88811423 CTGTCACTACTCCACACAGAAGG - Intergenic
1201925035 Y:19274897-19274919 GACTCACAATTCCACACTGCTGG + Intergenic