ID: 1138066958

View in Genome Browser
Species Human (GRCh38)
Location 16:53952171-53952193
Sequence GTAAATTCCCTAACCTCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 701
Summary {0: 1, 1: 3, 2: 13, 3: 108, 4: 576}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138066958_1138066963 12 Left 1138066958 16:53952171-53952193 CCCAGAGAGGTTAGGGAATTTAC 0: 1
1: 3
2: 13
3: 108
4: 576
Right 1138066963 16:53952206-53952228 AGGTTGTCAGTGGTCAAGCCAGG 0: 1
1: 0
2: 0
3: 29
4: 210
1138066958_1138066964 25 Left 1138066958 16:53952171-53952193 CCCAGAGAGGTTAGGGAATTTAC 0: 1
1: 3
2: 13
3: 108
4: 576
Right 1138066964 16:53952219-53952241 TCAAGCCAGGATTTGAGCCCAGG 0: 1
1: 7
2: 34
3: 231
4: 1022
1138066958_1138066961 -8 Left 1138066958 16:53952171-53952193 CCCAGAGAGGTTAGGGAATTTAC 0: 1
1: 3
2: 13
3: 108
4: 576
Right 1138066961 16:53952186-53952208 GAATTTACTCAGGATAGCACAGG 0: 1
1: 0
2: 0
3: 6
4: 116
1138066958_1138066962 2 Left 1138066958 16:53952171-53952193 CCCAGAGAGGTTAGGGAATTTAC 0: 1
1: 3
2: 13
3: 108
4: 576
Right 1138066962 16:53952196-53952218 AGGATAGCACAGGTTGTCAGTGG 0: 1
1: 0
2: 0
3: 12
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138066958 Original CRISPR GTAAATTCCCTAACCTCTCT GGG (reversed) Intronic
900734660 1:4290618-4290640 AAAATTTCCCCAACCTCTCTAGG - Intergenic
901328226 1:8382719-8382741 GCAAATTCCCTAACCTCTCTTGG + Intronic
901411818 1:9089624-9089646 GGAAACTCCCCCACCTCTCTGGG + Intergenic
901795767 1:11678619-11678641 GCAAATTCCTTAACTTCTCTGGG + Intronic
902124673 1:14198851-14198873 GTAACTTATTTAACCTCTCTGGG - Intergenic
902183744 1:14709892-14709914 GTAAGTATCTTAACCTCTCTGGG - Intronic
902532976 1:17102459-17102481 ATAAATTCCCTAACCTCTCTGGG + Intronic
902727687 1:18348133-18348155 GCAAGTTACTTAACCTCTCTGGG - Intronic
902791044 1:18768280-18768302 GAAAATTCCTGAACCTCTCTGGG - Intergenic
902871811 1:19318191-19318213 GCAAATTGCTTAACTTCTCTGGG - Intronic
902994839 1:20216228-20216250 GCAAGTTACCTAAACTCTCTGGG + Intergenic
903019392 1:20383471-20383493 GCAAATTACTTAACCTCTCTGGG - Intergenic
903326100 1:22569452-22569474 GTAAGTCCCTTGACCTCTCTGGG - Intronic
903343119 1:22667222-22667244 GCTAATTACTTAACCTCTCTGGG + Intergenic
903367857 1:22816021-22816043 GCCAATTACTTAACCTCTCTGGG + Intronic
903388263 1:22944250-22944272 GTTAATAGCCAAACCTCTCTAGG + Intergenic
903496714 1:23773440-23773462 GCAAATTGCTTAACCTCTCTAGG - Intergenic
903639579 1:24849121-24849143 GCAAATTATTTAACCTCTCTAGG - Intergenic
904256055 1:29255484-29255506 GCACATTACTTAACCTCTCTGGG + Intronic
904259892 1:29282517-29282539 GCAAGTCCCCTAACCTCCCTGGG - Intronic
904663371 1:32101648-32101670 GTCAAGTCCCTTTCCTCTCTGGG - Intronic
904918225 1:33985608-33985630 GTAAGTTGTTTAACCTCTCTTGG + Intronic
905453645 1:38073108-38073130 GTAGATCCCCTAACCGCTCAGGG + Intergenic
905661947 1:39734461-39734483 GTAAATTGCTTGACCTCCCTGGG + Intronic
905676726 1:39831304-39831326 GTGACTTACTTAACCTCTCTGGG + Intergenic
905791134 1:40790182-40790204 GCAAGTTACTTAACCTCTCTGGG + Intronic
905813541 1:40930565-40930587 GTGAATTCTCCAGCCTCTCTGGG + Intergenic
905914818 1:41677435-41677457 GTCAGTTCCTTAACTTCTCTGGG + Intronic
906144746 1:43553243-43553265 ACAAATCCCTTAACCTCTCTGGG + Intronic
906798694 1:48717843-48717865 GCAAATAATCTAACCTCTCTGGG + Intronic
906836459 1:49087681-49087703 AAAATTTCCCTAACCTCACTAGG + Intronic
907188453 1:52629865-52629887 GCAAGTTACTTAACCTCTCTGGG + Intergenic
907899301 1:58722740-58722762 ACAAATTACCTAGCCTCTCTGGG + Intergenic
907951413 1:59187397-59187419 GTAAGTTACTTAATCTCTCTGGG + Intergenic
908104197 1:60824698-60824720 GAAAATTACGTAACTTCTCTAGG - Intergenic
908111998 1:60907120-60907142 GTGAATTCCAAAGCCTCTCTAGG + Intronic
908391280 1:63685878-63685900 GGAATTTTCTTAACCTCTCTGGG - Intergenic
910685100 1:89907906-89907928 GCAAATCCCTTAACCTCTCCAGG - Intronic
911145552 1:94549254-94549276 GCAAATTATTTAACCTCTCTGGG - Intergenic
911263798 1:95719363-95719385 GTAAATACCATCACCTTTCTGGG + Intergenic
912404783 1:109427745-109427767 GTCAAGTCCTTAACCTCTCAAGG + Intergenic
912699576 1:111867051-111867073 ATAAGTTACCTAACTTCTCTGGG + Intronic
912708358 1:111931575-111931597 ATAAGTTGCTTAACCTCTCTGGG + Intronic
913676558 1:121146492-121146514 GCAAGTTACCTAAACTCTCTGGG + Intergenic
913717525 1:121552505-121552527 GCAAATTACCTAATTTCTCTTGG - Intergenic
913965176 1:143370854-143370876 GCAAATTACTTAACTTCTCTGGG + Intergenic
914028454 1:143934442-143934464 GCAAGTTACCTAAACTCTCTGGG + Intergenic
914059553 1:144196456-144196478 GCAAATTACTTAACTTCTCTGGG + Intergenic
914119597 1:144769915-144769937 GCAAATTACTTAACTTCTCTGGG - Intergenic
914427657 1:147592893-147592915 AAAAATTACCTAACCTCTCTAGG - Intronic
914925456 1:151882502-151882524 GCAAATTACCTAACCTCTCTGGG - Intronic
914973440 1:152333198-152333220 GCAAATTTCTTAACCTTTCTGGG + Intergenic
915087620 1:153398817-153398839 GGAAATTACTTATCCTCTCTGGG - Intergenic
915273267 1:154770662-154770684 GCAAGTTACTTAACCTCTCTGGG - Intronic
915373615 1:155372894-155372916 GTTAATTCCCTAACTACTATGGG - Intronic
915710633 1:157894779-157894801 GCAAATTGCTTAACCTCTCTGGG - Intronic
916178852 1:162066632-162066654 GCAAATTACTTAATCTCTCTGGG + Intergenic
916431109 1:164729670-164729692 GCAAGTTGCCTAACCTCTCTAGG - Intronic
916455670 1:164969030-164969052 ATAAATTGCCTAACTTCTCATGG + Intergenic
916725027 1:167515991-167516013 GCAAGTTACTTAACCTCTCTGGG - Intronic
916835792 1:168543645-168543667 GTAAATTCCTTAACCACTCAGGG - Intronic
916838677 1:168576935-168576957 GTAAATTCCTTAACCACTCAGGG + Intronic
918108483 1:181434130-181434152 GCAAATTGCTTAACCGCTCTGGG + Intronic
918160620 1:181895576-181895598 GTAAGTTCTCTAACTTCACTTGG + Intergenic
918572098 1:186008629-186008651 ATAAATTTCCTAAACCCTCTGGG + Intronic
919704063 1:200659577-200659599 GAAAATTCCGTAACATCTTTGGG + Intronic
919762896 1:201109520-201109542 GTAAGTCCCTGAACCTCTCTAGG + Intronic
920186704 1:204163822-204163844 GAAAGCTACCTAACCTCTCTGGG + Intronic
920210155 1:204322141-204322163 GAAAGCTTCCTAACCTCTCTGGG - Intronic
920214516 1:204352509-204352531 GAAAATTACTTAACCTCTCTGGG - Intronic
920390424 1:205596923-205596945 ACAAGTTCTCTAACCTCTCTAGG - Intronic
920463923 1:206165333-206165355 GCAAGTTACCTAAACTCTCTGGG + Intergenic
920973963 1:210768311-210768333 GCCAGTTACCTAACCTCTCTAGG - Intronic
922154795 1:223032356-223032378 CTCAGTTCCTTAACCTCTCTGGG + Intergenic
922441173 1:225656193-225656215 GCAAGTTACTTAACCTCTCTGGG - Intergenic
923589390 1:235305577-235305599 GTAAATTATATAATCTCTCTCGG + Intronic
924034468 1:239922323-239922345 GGAAATTCTAAAACCTCTCTTGG + Intergenic
1063063530 10:2584882-2584904 GTAATTTCCATAAATTCTCTGGG + Intergenic
1063880634 10:10528216-10528238 GTAAATTCTCCAAGCTTTCTGGG + Intergenic
1064081057 10:12308324-12308346 GTAAATTTCCTAACCGTCCTTGG + Intergenic
1064198857 10:13267692-13267714 GTAAATTACTTGACTTCTCTGGG - Intergenic
1064830623 10:19461968-19461990 CTAAATTCTCTGACCTATCTTGG + Intronic
1065798140 10:29326052-29326074 GCAAATTCATTAAACTCTCTGGG - Intergenic
1066138097 10:32472042-32472064 GTATATTACTTAACCTCTATTGG - Intronic
1066978574 10:42390988-42391010 GGAAACTCCCTCACCTCTCCAGG - Intergenic
1068587998 10:58821822-58821844 GTGAGTTTCCAAACCTCTCTTGG + Intronic
1068632735 10:59314411-59314433 ACAGATTCCCTAACCTCTCTGGG - Intronic
1069294793 10:66830430-66830452 GTAAATAACTTAACCTCTGTCGG - Intronic
1069944292 10:71975284-71975306 ACAAGTTGCCTAACCTCTCTGGG - Intronic
1069986518 10:72288048-72288070 GCAACTTCACAAACCTCTCTTGG - Intergenic
1070175744 10:73967700-73967722 GCAAATGACTTAACCTCTCTGGG - Intergenic
1070320560 10:75351853-75351875 GTGAATTGCTTTACCTCTCTGGG + Intergenic
1070321414 10:75357676-75357698 GCAAATTACTTAACATCTCTGGG - Intergenic
1070386099 10:75926008-75926030 GCAAGTTACTTAACCTCTCTGGG - Intronic
1070503284 10:77091229-77091251 GTAAATTCCTTTAGCTCTCCTGG - Intronic
1070600128 10:77860155-77860177 GTCAATTACCTAACCTTGCTGGG - Intronic
1070666834 10:78350908-78350930 GTAAATTACTTCACCTTTCTGGG + Intergenic
1070753039 10:78975060-78975082 GGCAATTCCTTAACCTTTCTGGG - Intergenic
1070981602 10:80652866-80652888 GGAGATTCCCTACCCTCTCTGGG + Intergenic
1071574212 10:86714185-86714207 GCAAGTTCCTTAACCTCTCTGGG - Intronic
1071703111 10:87964004-87964026 ACAAGTTCCCTAACCTTTCTGGG + Intronic
1071728445 10:88223075-88223097 GCAAATTACATAACCTTTCTGGG - Intergenic
1071862560 10:89689218-89689240 GTAATTTCCCTGACCTGCCTAGG + Intergenic
1072300677 10:94058684-94058706 GCAAATCACCTAACCTGTCTAGG + Intronic
1072682839 10:97518965-97518987 GCAAATTACACAACCTCTCTGGG - Intronic
1073170461 10:101503074-101503096 GTAAATTAATTAACTTCTCTGGG - Intronic
1073328074 10:102653977-102653999 ACAAATTACTTAACCTCTCTAGG + Intronic
1073414143 10:103367478-103367500 GTAAGTTATTTAACCTCTCTTGG + Intergenic
1073625306 10:105090703-105090725 AAAAACTCCTTAACCTCTCTGGG + Intronic
1074688050 10:115977767-115977789 GCACATTTCTTAACCTCTCTGGG + Intergenic
1074883914 10:117679956-117679978 GCCAAGTCTCTAACCTCTCTGGG - Intergenic
1075212776 10:120505159-120505181 GCAAGTTCCCTCATCTCTCTTGG - Intronic
1075275116 10:121086247-121086269 GTCAGTTGCTTAACCTCTCTGGG - Intergenic
1075684962 10:124357356-124357378 GCAACTTTCTTAACCTCTCTGGG + Intergenic
1076091215 10:127687679-127687701 GGAGATTCCCTACCCTTTCTGGG - Intergenic
1077640633 11:3878364-3878386 GTAAGTTGCTTAACCTCTCTGGG - Intronic
1077806083 11:5592409-5592431 GCAAGTTACTTAACCTCTCTTGG - Intronic
1078466946 11:11557412-11557434 TTAAATTACCTAATTTCTCTGGG + Intronic
1078792385 11:14557632-14557654 ATGAATTCCCTCACCCCTCTAGG - Intronic
1079079309 11:17402846-17402868 GTGAATGGCCTTACCTCTCTAGG + Intronic
1079096259 11:17512311-17512333 CTAAGTTCCTTAACCTCTCTGGG + Intronic
1079110799 11:17604058-17604080 GTAAATCACTTAATCTCTCTGGG - Intronic
1079145842 11:17851060-17851082 ATAAATTAGCTAACCTCCCTAGG + Intronic
1079279511 11:19074810-19074832 GCAAGTTGCTTAACCTCTCTAGG - Intergenic
1080039095 11:27740058-27740080 ATACATTACTTAACCTCTCTGGG - Intergenic
1080414459 11:32056276-32056298 GTAAGTCCCTTTACCTCTCTGGG - Intronic
1081467002 11:43329454-43329476 GCAGGTACCCTAACCTCTCTTGG + Intronic
1081576896 11:44324358-44324380 GTGAGTTACTTAACCTCTCTGGG + Intergenic
1081655166 11:44852371-44852393 GAAAATGCCTTAACTTCTCTGGG - Intronic
1081795643 11:45817479-45817501 GCAAGTCCCCTAACCTTTCTGGG + Intergenic
1081855853 11:46303210-46303232 GCAAGTTACTTAACCTCTCTAGG + Intronic
1081980847 11:47265988-47266010 GTAAGTTATTTAACCTCTCTGGG - Intronic
1082029144 11:47592316-47592338 GCAGGTTCCCTAACTTCTCTGGG + Intronic
1082072871 11:47953025-47953047 ACAAATTCCTAAACCTCTCTGGG + Intergenic
1082268123 11:50141678-50141700 GACAATTGCTTAACCTCTCTGGG - Intergenic
1082287953 11:50336840-50336862 GACAATTTCTTAACCTCTCTGGG + Intergenic
1083191401 11:61055078-61055100 GCAAGTTCCCTAACGACTCTGGG + Intergenic
1083278008 11:61608515-61608537 GGAAAGTGCCTAACCTCTCTGGG - Intergenic
1083283237 11:61640556-61640578 GCAAATGCACTCACCTCTCTGGG + Intergenic
1085332605 11:75666830-75666852 GCAAGTTTCCTAACCTTTCTGGG - Intronic
1085394249 11:76198792-76198814 GTAAGTTATCCAACCTCTCTGGG + Intronic
1086189161 11:84057827-84057849 GCAAATTGCTTAACCTCTCTGGG - Intronic
1086453011 11:86935712-86935734 GTAAGTTACTTAACCTCTCTGGG - Intronic
1086908165 11:92440901-92440923 GTACATTCCTTAACCTGACTGGG + Intronic
1087059183 11:93961885-93961907 GCAAGTTCCCTAGCCTCTCTGGG - Intergenic
1087259998 11:96000743-96000765 GTCAATTCCTTAAACTTTCTGGG - Intronic
1089040693 11:115446571-115446593 GTGAGTTACTTAACCTCTCTGGG - Intronic
1089223389 11:116894622-116894644 GAAAATTGCCTAATCTCTCCTGG + Intronic
1089310149 11:117552523-117552545 GTAAATCACTTAATCTCTCTGGG + Intronic
1089397764 11:118146842-118146864 GCAAGTTACATAACCTCTCTAGG - Intronic
1090029849 11:123196659-123196681 GAAACTTCCATAACCTCTCCAGG - Intergenic
1090220558 11:125019440-125019462 GCAAATTACCTAACCTTTCTAGG - Intronic
1090611495 11:128474967-128474989 TGAAATGCCCTAACTTCTCTGGG + Intronic
1091363787 11:135000235-135000257 GGAAATTCCCCTACTTCTCTGGG + Intergenic
1091787783 12:3253399-3253421 GTAAGTTCCTTGACCTCTCTGGG + Intronic
1092005088 12:5062417-5062439 GCAAGTTACTTAACCTCTCTGGG - Intergenic
1092144162 12:6203169-6203191 ATAAGTCACCTAACCTCTCTGGG - Intronic
1092845853 12:12584517-12584539 GCAAGTTCCTTAGCCTCTCTGGG - Intergenic
1093201608 12:16193722-16193744 GAAAATTCTCTAACCTCTCTGGG - Intronic
1093843148 12:23930721-23930743 GTAAATTCTTTAACTTCCCTGGG - Intronic
1095479875 12:42623815-42623837 GCAAATTATCTAACCTCTCTGGG + Intergenic
1096210880 12:49764917-49764939 GAAAATTCCTTAACCTTTCCTGG + Exonic
1096614595 12:52824661-52824683 GCACATTCACTAACCCCTCTAGG + Intronic
1097203546 12:57300598-57300620 GCAAATTACCTGACCTCTCCAGG + Intronic
1097204610 12:57309756-57309778 GTAAAATCCCTAATCTATTTGGG - Intronic
1097287239 12:57887795-57887817 GAAAGTTACTTAACCTCTCTGGG - Intergenic
1097391100 12:59014277-59014299 GCAATTTACATAACCTCTCTGGG + Intergenic
1097425023 12:59433774-59433796 GTAAGTTCCCTAACTTCTCAAGG + Intergenic
1097880070 12:64678898-64678920 GCAAGTTACTTAACCTCTCTGGG - Intronic
1098133982 12:67382104-67382126 GAAAATTACTTAACCTCCCTGGG - Intergenic
1099379937 12:81940822-81940844 GGAAATTGCCTAATCTCCCTTGG - Intergenic
1100247746 12:92780532-92780554 GCAAATTACTTACCCTCTCTTGG + Intronic
1100482451 12:94992349-94992371 GCAAGTTCCTTAACCTCTCTGGG - Intronic
1100601368 12:96114186-96114208 GGAAATTCCCTGTCCTCCCTGGG - Intergenic
1101031001 12:100660103-100660125 GCAAGTTACTTAACCTCTCTGGG + Intergenic
1101199552 12:102420338-102420360 GAAAAGTCACTAAGCTCTCTGGG + Intronic
1101330868 12:103756949-103756971 GCAAATTACCTACCTTCTCTGGG + Intronic
1101369126 12:104108802-104108824 GTAAACACCCTGACATCTCTAGG - Intergenic
1101594459 12:106151632-106151654 GTAACTTGCTTAACTTCTCTGGG + Intergenic
1101758022 12:107636388-107636410 GAAAAGTCCCCAACCTATCTAGG - Intronic
1101813353 12:108127023-108127045 GTAAGTTAATTAACCTCTCTGGG - Intergenic
1102331085 12:112031496-112031518 GAAAGTTACCTAACCTCTCTAGG - Intronic
1102352882 12:112207536-112207558 GAAAATTACTTAACATCTCTGGG - Intronic
1102531826 12:113552466-113552488 GTGAATTTCTTAACCTCTCCTGG + Intergenic
1102571179 12:113827832-113827854 GTAAGTTGCTTCACCTCTCTGGG + Intronic
1102991063 12:117316623-117316645 ACAAATTACCTAATCTCTCTGGG - Intronic
1103192446 12:119013278-119013300 GTTAATTGCTTAGCCTCTCTGGG - Intronic
1103217814 12:119216291-119216313 GTAACTGACATAACCTCTCTGGG + Intronic
1103978650 12:124721187-124721209 GCAAGTTACCTAACCTCTCTGGG + Intergenic
1104057953 12:125244916-125244938 GTGAATTCACTTCCCTCTCTCGG + Intronic
1104493316 12:129213533-129213555 ATAAATTACCCAGCCTCTCTAGG - Intronic
1105050726 12:133048470-133048492 GAAAGTTACTTAACCTCTCTTGG - Intronic
1106235162 13:27855285-27855307 GTAAGTTACTTAACATCTCTGGG - Intergenic
1106532884 13:30610547-30610569 GCAAATTATTTAACCTCTCTGGG - Intronic
1106695553 13:32168994-32169016 GCAAATTCCTTAACCACTCTGGG + Intronic
1108333681 13:49416663-49416685 ACAAATTACTTAACCTCTCTGGG + Intronic
1108334377 13:49423846-49423868 TTAAATTCCTTAACTTTTCTAGG - Intronic
1108404541 13:50086785-50086807 GTACATGTCCTAATCTCTCTGGG + Intronic
1108594751 13:51939933-51939955 GTAAAGACTCTAATCTCTCTGGG + Intronic
1108747057 13:53406653-53406675 GAAAGTTACTTAACCTCTCTGGG - Intergenic
1108903303 13:55439653-55439675 GTAACTTCCCTAGCAACTCTAGG - Intergenic
1109065107 13:57677196-57677218 GCCAATTCCCTAGACTCTCTTGG + Intronic
1109297112 13:60547492-60547514 GTAAGTTACCTAATATCTCTGGG + Intronic
1110498086 13:76192479-76192501 GTTAAATTCCTAACATCTCTGGG + Intergenic
1110665996 13:78118121-78118143 GTAAAGTATTTAACCTCTCTGGG - Intergenic
1110743998 13:79031397-79031419 GAAAATTGTGTAACCTCTCTGGG - Intergenic
1111480569 13:88820180-88820202 GTAAATTACTTAACTTCTCCAGG - Intergenic
1111787165 13:92803441-92803463 GGAAATTCCATAAACTCTCTTGG + Intronic
1111849778 13:93558116-93558138 GTAAGTTTCTTAAACTCTCTGGG + Intronic
1112225334 13:97533887-97533909 GCAAATTACTTAACCTCTCTGGG + Intergenic
1112694146 13:101928660-101928682 GCAAATTACCTAACCTCCATGGG - Intronic
1113719073 13:112539246-112539268 GCAAATACCTTCACCTCTCTGGG - Intronic
1114824630 14:26062303-26062325 GTAAGTTTCTTAATCTCTCTGGG - Intergenic
1115345900 14:32343174-32343196 GAAACTTGCCTAACCTTTCTGGG + Intronic
1115524310 14:34264272-34264294 GTTAATTACATAACCTCTCTGGG + Intronic
1118592417 14:67411521-67411543 GCAAGTTCCCTAACTCCTCTGGG + Intronic
1118614708 14:67567465-67567487 TTAAATTCCATGACCACTCTGGG + Intronic
1119058454 14:71448410-71448432 GCAAGTTGCTTAACCTCTCTGGG - Intronic
1119534867 14:75394824-75394846 GTAAATTACTTACCATCTCTGGG + Intergenic
1119768808 14:77207336-77207358 ATAAGTTTCTTAACCTCTCTGGG + Intronic
1121537026 14:94697950-94697972 GTCTAATCCCTACCCTCTCTGGG + Intergenic
1122078323 14:99249676-99249698 GTAAATAACTTAACATCTCTGGG + Intronic
1122094277 14:99360013-99360035 GTAAATTACCTAATCACTCTGGG + Intergenic
1122414762 14:101543599-101543621 GAAAAGTCCCTACCCTCTCTGGG + Intergenic
1122747150 14:103905063-103905085 GCAAACTCCGTAACTTCTCTGGG - Intergenic
1124655400 15:31503065-31503087 GGACATTGCCTAGCCTCTCTGGG + Intronic
1126543913 15:49852112-49852134 GAAAGTTACTTAACCTCTCTGGG + Intergenic
1127659227 15:61084370-61084392 GCAAATTGCATACCCTCTCTAGG + Intronic
1128004069 15:64221660-64221682 GCACATTCCTTAGCCTCTCTGGG + Intronic
1128165011 15:65456304-65456326 TTGAATACCCTAGCCTCTCTAGG - Exonic
1128616063 15:69110719-69110741 ATCAATTGCTTAACCTCTCTGGG + Intergenic
1128645476 15:69375686-69375708 ATAAATGCCCTAACCTCTCCAGG + Intronic
1129685226 15:77682206-77682228 GCAAATTACCTAACCTTTCTGGG + Intronic
1130394421 15:83489660-83489682 GGAAAGTCACTAACCCCTCTGGG + Intronic
1130688639 15:86061005-86061027 GCAAATGACTTAACCTCTCTGGG + Intergenic
1130918275 15:88323156-88323178 GCAAGTTTCTTAACCTCTCTGGG - Intergenic
1132264931 15:100461454-100461476 GCAAGTTCCATAATCTCTCTGGG + Intronic
1132988785 16:2782530-2782552 CCAAGTTACCTAACCTCTCTGGG + Intergenic
1133011435 16:2914186-2914208 GCAAATCCCGTAACTTCTCTGGG - Exonic
1133198949 16:4190619-4190641 GTGATCTCCCTAATCTCTCTTGG + Exonic
1133695324 16:8257585-8257607 GCAAGTTAACTAACCTCTCTAGG + Intergenic
1133760766 16:8796814-8796836 GTAAATATCTTACCCTCTCTGGG - Intronic
1133772971 16:8878387-8878409 GGGCATCCCCTAACCTCTCTGGG - Intergenic
1133820491 16:9232040-9232062 GCAAATTACATCACCTCTCTTGG - Intergenic
1133969893 16:10560004-10560026 GGAAGTTGTCTAACCTCTCTGGG - Intronic
1134051741 16:11142142-11142164 GCAAGTTACCTCACCTCTCTGGG - Intronic
1134104057 16:11472607-11472629 ACAAATTACTTAACCTCTCTGGG + Intronic
1134197752 16:12171896-12171918 GGCAATTCCCTGACCTCTCTGGG + Intronic
1134278000 16:12793513-12793535 GCAAGTTCCTGAACCTCTCTGGG + Intronic
1134501170 16:14770213-14770235 GACAAATTCCTAACCTCTCTGGG + Intronic
1134539821 16:15055641-15055663 GCAAGTCACCTAACCTCTCTGGG + Intronic
1134579410 16:15358819-15358841 GACAAATTCCTAACCTCTCTGGG - Intergenic
1134723172 16:16398732-16398754 GACAAATTCCTAACCTCTCTGGG + Intergenic
1134802469 16:17098292-17098314 ACAAATTCCCTAATCTCTCTGGG - Intergenic
1134944256 16:18313138-18313160 GACAAATTCCTAACCTCTCTGGG - Intergenic
1135044091 16:19140455-19140477 GGGAAGTCACTAACCTCTCTGGG - Intronic
1135079134 16:19419131-19419153 GTGAGTTACTTAACCTCTCTGGG + Intronic
1135155314 16:20047819-20047841 GCAATTTACTTAACCTCTCTGGG + Intronic
1135343055 16:21665089-21665111 GCAAATTCCTTAACCTCTATAGG - Intergenic
1136091575 16:27923957-27923979 GGAAGTTACCTAACCTCTCTGGG + Intronic
1136414301 16:30094402-30094424 GCAAGTTACCTAACATCTCTGGG + Intronic
1136416957 16:30110021-30110043 GCAAATTACAGAACCTCTCTGGG + Intronic
1137430626 16:48415497-48415519 GCAAATTTCATAACCCCTCTGGG + Intronic
1137524185 16:49219428-49219450 GCAAGTTCCTTTACCTCTCTGGG + Intergenic
1137564327 16:49523950-49523972 GTAAGTCACTTAACCTCTCTGGG + Intronic
1138066958 16:53952171-53952193 GTAAATTCCCTAACCTCTCTGGG - Intronic
1138130397 16:54474608-54474630 GTAAATCACTTAACTTCTCTGGG + Intergenic
1138245793 16:55466438-55466460 TCAAATTCCTTAACTTCTCTGGG + Intronic
1138274922 16:55727389-55727411 GCAGGTTCTCTAACCTCTCTGGG + Intergenic
1138407203 16:56805839-56805861 TCAAATTCCCTGACCTCTATAGG + Intronic
1139690469 16:68638430-68638452 GTGAGTTCCCTGACCCCTCTAGG - Intronic
1139694489 16:68664047-68664069 GCAAGTTGGCTAACCTCTCTGGG - Intronic
1140954149 16:79846962-79846984 GAAAATTCCCTGACCTCTTCTGG + Intergenic
1141141932 16:81502127-81502149 GTACGTTACTTAACCTCTCTGGG - Intronic
1141431517 16:83972638-83972660 GCAAATTGCTTAACCTCTCTGGG - Intronic
1141598833 16:85113350-85113372 GCAAGTCCCCTGACCTCTCTGGG + Intergenic
1141631866 16:85292068-85292090 GCACATTGCTTAACCTCTCTGGG + Intergenic
1141768780 16:86076026-86076048 GCAAGTTACTTAACCTCTCTGGG - Intergenic
1141768993 16:86077439-86077461 GCAAGTTACTTAACCTCTCTGGG + Intergenic
1141933942 16:87224034-87224056 GCAACTTGCTTAACCTCTCTGGG - Intronic
1142601538 17:1055405-1055427 GCAAGTTTCTTAACCTCTCTGGG - Intronic
1144833866 17:18146498-18146520 GTAAGTTACTTAACCTCTCTGGG + Intronic
1145226627 17:21134404-21134426 GTGAATTTCCTCACCTCTTTAGG + Intronic
1145827763 17:27890055-27890077 GCAAATTACTTAACCTCTCAGGG - Intronic
1146094095 17:29911514-29911536 GCAAGTTGCATAACCTCTCTTGG - Intronic
1146376551 17:32298502-32298524 GGAAATTTCCTAACCTCTTTTGG + Intronic
1147234570 17:39047756-39047778 GTAATTTCACTAACCTGCCTTGG - Intergenic
1147321974 17:39652053-39652075 GTAAATCCATTCACCTCTCTGGG + Intronic
1148546453 17:48522774-48522796 GTAAGTCACTTAACCTCTCTGGG - Intergenic
1149168986 17:53787262-53787284 GTAAACTCACCAAGCTCTCTGGG + Intergenic
1150017931 17:61578217-61578239 GTAAATTACTTAACCTCTTCGGG - Intergenic
1150980921 17:70140462-70140484 GCAATTTACTTAACCTCTCTGGG + Intergenic
1151295648 17:73184331-73184353 GCAAATTACATAACCTCCCTTGG + Intergenic
1152012722 17:77728282-77728304 GAAAACTGCCTAAGCTCTCTGGG - Intergenic
1152162833 17:78679750-78679772 GCAAATTTCTTAACCTCTATGGG + Intronic
1152249458 17:79203987-79204009 CTAAATTCCCTGAACGCTCTGGG + Intronic
1152383302 17:79953515-79953537 GCAAATTACTTAACCTCTCTGGG - Intronic
1152963959 18:97649-97671 GCAACTCGCCTAACCTCTCTGGG - Intergenic
1153265357 18:3263399-3263421 ACAAATTACCTCACCTCTCTGGG - Intronic
1153503060 18:5768374-5768396 ACAAATTCCTTCACCTCTCTAGG + Intergenic
1153753373 18:8256327-8256349 GCAAGTTATCTAACCTCTCTGGG + Intronic
1154109264 18:11551888-11551910 GGAAATTCCCTATCCTCTGGAGG + Intergenic
1155505576 18:26529375-26529397 GCCACTTCCCTATCCTCTCTAGG + Intronic
1156962779 18:43052981-43053003 GTAAGTTTTCAAACCTCTCTGGG - Intronic
1157122625 18:44925873-44925895 GCAAGTAACCTAACCTCTCTGGG - Intronic
1157171318 18:45408873-45408895 GTATATTACTTTACCTCTCTGGG + Intronic
1157180139 18:45489961-45489983 GCAAGTCCCCTAATCTCTCTGGG - Intronic
1158276772 18:55778084-55778106 GCAACTTTCTTAACCTCTCTGGG - Intergenic
1159010334 18:63053130-63053152 GTAAATTTCCTGGCTTCTCTAGG + Intergenic
1159137707 18:64356372-64356394 GAAAAATCCAAAACCTCTCTTGG + Intergenic
1159597755 18:70399275-70399297 TTAAATTATCTAACCTTTCTAGG - Intergenic
1159607120 18:70486341-70486363 ATAAATTCCTCATCCTCTCTTGG - Intergenic
1160015396 18:75136215-75136237 GCCAATTCCTTAAACTCTCTCGG + Intergenic
1161100808 19:2420666-2420688 GCAAGTGCCTTAACCTCTCTGGG + Intronic
1161275238 19:3412631-3412653 GTAATTTGCTTACCCTCTCTGGG + Intronic
1161623029 19:5309242-5309264 GCAAGTGCCTTAACCTCTCTGGG + Intronic
1161646112 19:5454509-5454531 CTAAATTCCTTAGCCTCTCTGGG - Intergenic
1161787485 19:6336346-6336368 GTAAGTTCCTTAACTTCTCTGGG - Intergenic
1162343671 19:10107255-10107277 GCAAGTTACTTAACCTCTCTGGG + Intronic
1162426084 19:10596799-10596821 GTAAATTACTTCACCTCTCTGGG + Intergenic
1162780658 19:13005458-13005480 GCAAGTTGCTTAACCTCTCTGGG + Intronic
1163463282 19:17452027-17452049 GCACATCCCTTAACCTCTCTGGG + Intronic
1163511963 19:17740890-17740912 GAATGTTCCTTAACCTCTCTGGG + Intergenic
1164685050 19:30161067-30161089 GTAAAGTCCTCAACCTCTCTGGG - Intergenic
1164852858 19:31499342-31499364 GAAAACTCCTTCACCTCTCTGGG + Intergenic
1165307116 19:35009602-35009624 GTGAGTTACTTAACCTCTCTGGG + Intronic
1165416699 19:35698608-35698630 GCAAATTGCTTAACCCCTCTGGG - Intergenic
1165465352 19:35971426-35971448 ATAAATTATTTAACCTCTCTGGG + Intergenic
1165948051 19:39457142-39457164 GCAAGTTCCTTAATCTCTCTGGG + Intronic
1166802117 19:45464529-45464551 GTGAATAACTTAACCTCTCTGGG + Intronic
1166889807 19:45983885-45983907 GCAAGTTACTTAACCTCTCTGGG + Intergenic
1166893619 19:46009509-46009531 CCAAGTTCCCTAACTTCTCTGGG - Intronic
1168523014 19:57067683-57067705 GCAAGTTACTTAACCTCTCTGGG + Intergenic
1202698954 1_KI270712v1_random:148342-148364 GCAAATTACTTAACTTCTCTGGG + Intergenic
925579453 2:5395868-5395890 GTAACTTCCCAGGCCTCTCTAGG + Intergenic
926298959 2:11588752-11588774 GGAACTTCCCTTACCTCTGTGGG + Exonic
926809005 2:16739965-16739987 GCAAGTTACTTAACCTCTCTGGG - Intergenic
927060000 2:19408246-19408268 GCAAATTGATTAACCTCTCTGGG - Intergenic
927108103 2:19844907-19844929 GCCAATTCCCACACCTCTCTGGG + Intergenic
927706195 2:25297909-25297931 GCAAGTCACCTAACCTCTCTGGG - Intronic
928093673 2:28391652-28391674 ACGAATTCCTTAACCTCTCTGGG - Intergenic
928344272 2:30476273-30476295 GCAAATTATTTAACCTCTCTGGG - Intronic
928964608 2:36964945-36964967 GGAAATCCTTTAACCTCTCTGGG - Intronic
929042481 2:37758947-37758969 GTAAATTACTTAACCTCCCTAGG + Intergenic
931213472 2:60219740-60219762 GCAAATCCCTTCACCTCTCTGGG + Intergenic
931946177 2:67310431-67310453 GCAAGTTTCCTAACCTCTGTGGG + Intergenic
932599735 2:73115195-73115217 GCCAACTCTCTAACCTCTCTTGG + Intronic
932734138 2:74242522-74242544 ATGAATTACATAACCTCTCTGGG - Intronic
933260725 2:80128419-80128441 GTCTAGTCCCTATCCTCTCTGGG + Intronic
935348216 2:102128866-102128888 GCAAGTTCCTTAACTTCTCTAGG + Intronic
935692197 2:105742159-105742181 CTAAATACCCCAGCCTCTCTGGG + Intergenic
935746247 2:106192751-106192773 ATAAATTTCCTAATCTCTCTTGG + Intronic
936012140 2:108931572-108931594 GCAAATCACTTAACCTCTCTGGG - Intronic
936033083 2:109087625-109087647 GCAAATTACTGAACCTCTCTGGG + Intergenic
936511620 2:113152674-113152696 CTTACTTCCCTGACCTCTCTTGG + Intergenic
936698694 2:114983850-114983872 GTAAATTGCTTAACCTCTCCAGG - Intronic
936746007 2:115577371-115577393 GCCAATTACCTAACCTCTCTGGG + Intronic
937036683 2:118787952-118787974 GTAAGTTGCTTAACCTCTCTGGG - Intergenic
937495941 2:122419367-122419389 ATAACTTCCTTAACCTCTCTTGG - Intergenic
937759339 2:125581653-125581675 GTAAACTAATTAACCTCTCTAGG + Intergenic
938609935 2:132937073-132937095 GTAAATTCCCCAGCTTCTATAGG - Intronic
938626637 2:133116792-133116814 GCAAATTGCTTAACCTTTCTGGG + Intronic
939400639 2:141688605-141688627 GTAAATCATATAACCTCTCTGGG - Intronic
940058948 2:149543527-149543549 GTAAATTGTGTGACCTCTCTTGG - Intergenic
940825217 2:158403985-158404007 GTAAATTACTTAACCTCTCTTGG + Intronic
940865623 2:158815001-158815023 GTAAATTCCACAAGGTCTCTGGG + Intronic
940970361 2:159890098-159890120 GTAACTTTTCTGACCTCTCTTGG - Intronic
940979365 2:159984410-159984432 CTAAAATTCTTAACCTCTCTTGG - Intronic
942205248 2:173613577-173613599 GCAAGTTACTTAACCTCTCTGGG + Intergenic
942229126 2:173843259-173843281 GTAAACTACCTAACCTTTCTGGG - Intergenic
943337029 2:186628076-186628098 GTAATTCACCTAACCACTCTGGG + Intronic
945215972 2:207434411-207434433 GCAAATTACCTAACTTCTCTGGG - Intergenic
945485427 2:210389944-210389966 GTAAATTGCTTGACATCTCTGGG + Intergenic
945628894 2:212246104-212246126 GTAGATTAACTGACCTCTCTGGG + Intronic
945689537 2:213016264-213016286 GGAAATTACTTAACATCTCTGGG - Intronic
946005561 2:216521641-216521663 GTAAGTTTCCTAACCTCTCGAGG + Intronic
946132101 2:217614548-217614570 GCAAATTCCCTAATTTCTCTAGG - Intronic
946275210 2:218626507-218626529 GCAAGTTACCTAACCTCTCATGG + Intronic
946449642 2:219768895-219768917 GCAAGTTACTTAACCTCTCTTGG - Intergenic
946611253 2:221460516-221460538 GTACATTTCCCAACCTCACTTGG - Intronic
946819161 2:223612720-223612742 GCAAATTACTTAACCTCCCTGGG + Intergenic
947075235 2:226335955-226335977 GAAAATTACTTAACCTCTCTTGG + Intergenic
948158163 2:235801243-235801265 GCAAATTACTTGACCTCTCTGGG + Intronic
948794615 2:240395885-240395907 GCAAATCTCCTCACCTCTCTGGG - Intergenic
1168962058 20:1876703-1876725 GCAAGTTGCTTAACCTCTCTGGG + Intergenic
1169843149 20:9961657-9961679 GTAAATTACTTAACCCCTTTGGG - Intergenic
1170594606 20:17795548-17795570 GCAAATCGCTTAACCTCTCTGGG - Intergenic
1171967107 20:31538974-31538996 GCAAATTTCTTAACCTCTCTGGG - Intronic
1172093403 20:32448868-32448890 GCAAATTCTTTAACTTCTCTGGG + Intronic
1172164218 20:32889125-32889147 ATAAACTCCCTAGCCTCCCTGGG - Intronic
1173335380 20:42108352-42108374 GCAAATGACTTAACCTCTCTGGG + Intronic
1173838472 20:46140690-46140712 GCAAGTTGCCTTACCTCTCTGGG - Intergenic
1173933240 20:46839346-46839368 GAAAAGTTCTTAACCTCTCTAGG - Intergenic
1174000270 20:47369444-47369466 GTAAGTAACTTAACCTCTCTGGG + Intergenic
1174205179 20:48833048-48833070 GTAAGTGACTTAACCTCTCTGGG + Intergenic
1174303584 20:49599903-49599925 GCAAATTACTTCACCTCTCTGGG - Intergenic
1175027556 20:55918707-55918729 GTGAATTACTTAACCTCTCTAGG - Intergenic
1175074557 20:56361574-56361596 GTAAATTACTCAACCTCTCTGGG + Intronic
1175142367 20:56870501-56870523 GTAAGTTATCTAACCTTTCTAGG - Intergenic
1175566988 20:59988174-59988196 GTAAAGGACCTAACCCCTCTGGG - Intronic
1178704626 21:34863127-34863149 GAAAATTACTTAACCTTTCTGGG - Intronic
1179037772 21:37774190-37774212 GTAAGTTTCTTAATCTCTCTGGG + Intronic
1179334633 21:40439090-40439112 GCAAATTGCTGAACCTCTCTGGG + Intronic
1181530365 22:23513902-23513924 GTAACTCGCCTAACCTCTCTGGG - Intergenic
1181750271 22:24984306-24984328 GAAAACTGCTTAACCTCTCTGGG - Intronic
1181904330 22:26181617-26181639 GTAAATTACTTAACCTCTCTAGG + Intronic
1181953701 22:26572979-26573001 GTAAATCACTTAACCTCTCTGGG + Intronic
1181983195 22:26781240-26781262 GCAAGTTGCTTAACCTCTCTGGG - Intergenic
1182364222 22:29767053-29767075 TTAGATTCCCAAAGCTCTCTGGG - Intergenic
1182587102 22:31350308-31350330 GCAAGTTACTTAACCTCTCTGGG - Intergenic
1183095232 22:35547983-35548005 GTGAGTTACTTAACCTCTCTGGG - Intronic
1183853076 22:40608362-40608384 ACAAATTGTCTAACCTCTCTGGG - Intronic
1184413978 22:44341552-44341574 GCAAGTCCCCTAACCTCTCTGGG - Intergenic
1184675269 22:46038291-46038313 GCAAGTTTCTTAACCTCTCTGGG + Intergenic
1203294671 22_KI270736v1_random:30441-30463 GTAAATTACTTAACCTCCCTAGG + Intergenic
949609369 3:5688419-5688441 GCAAATTACTTAACTTCTCTGGG - Intergenic
950262524 3:11553231-11553253 GCCAATTGCCTTACCTCTCTGGG + Intronic
950549219 3:13656044-13656066 GCAAGTCCCCTAACTTCTCTGGG + Intergenic
950556636 3:13699999-13700021 GGAAGTCTCCTAACCTCTCTGGG - Intergenic
950915200 3:16637561-16637583 GTAAGTTACTTAGCCTCTCTGGG + Intronic
951027141 3:17842198-17842220 GCAAATTACTTAACCTCCCTGGG + Intronic
951152733 3:19311334-19311356 GCAAATTACTTAACCTCTTTTGG - Intronic
952255596 3:31692767-31692789 GTAAATTGCAAAACCTCTCTGGG - Intronic
952824564 3:37514242-37514264 ACACATTACCTAACCTCTCTGGG - Intronic
953158815 3:40399451-40399473 GTAAGTTGCCTAACCTTTCTGGG - Intronic
953420183 3:42748248-42748270 GCAAATTACCTCCCCTCTCTGGG - Intronic
954931181 3:54283283-54283305 GTAAAATCCCTGCCCTCTGTAGG + Intronic
955683397 3:61526037-61526059 GTAAATTACTTCAACTCTCTAGG - Intergenic
956080687 3:65552473-65552495 GCAAAATTCCTAACCACTCTTGG + Intronic
956315866 3:67936078-67936100 GTAAATTCCCTCATCTCTCCTGG - Intergenic
956599999 3:71010359-71010381 GTAAATCATTTAACCTCTCTGGG + Intronic
956675480 3:71728453-71728475 GTAAGTCACCTCACCTCTCTGGG - Intronic
956720411 3:72112636-72112658 GCAACTTACTTAACCTCTCTGGG + Intergenic
956839008 3:73119907-73119929 GTAAATTACCTAATTTATCTTGG + Intergenic
957038380 3:75316045-75316067 GCAAATCACTTAACCTCTCTGGG - Intergenic
959411144 3:106023435-106023457 GTAAATTCTCTAAGCAATCTTGG + Intergenic
960252651 3:115473352-115473374 GCAAGTTACTTAACCTCTCTAGG - Intergenic
960252782 3:115474878-115474900 GCAAGTTCCTTAACCTCTCTAGG - Intergenic
960587632 3:119334839-119334861 GCAAATTACTTAACTTCTCTGGG - Intronic
960855016 3:122093833-122093855 GTAAATTACTTCATCTCTCTGGG - Intronic
960954903 3:123025405-123025427 GTGAACTTACTAACCTCTCTGGG + Intronic
961086410 3:124071358-124071380 GCAAATCACTTAACCTCTCTGGG - Intergenic
961683364 3:128613604-128613626 GGCAAGTCCCTGACCTCTCTGGG - Intergenic
962386067 3:134933664-134933686 GTAAATTGCCTAAGGTCTCATGG + Intronic
962864198 3:139433918-139433940 GCAAATTACTTAACCTCTATGGG + Intergenic
962892325 3:139683115-139683137 GAAAATCCTCTAACCTCTCTGGG - Intergenic
962967126 3:140365601-140365623 TTAAGTCCCCTCACCTCTCTGGG - Intronic
964394089 3:156227610-156227632 ACAAATTTCCTAACTTCTCTGGG - Intronic
964620328 3:158714759-158714781 GCAAGTTCCCTTTCCTCTCTAGG - Intronic
964721124 3:159768057-159768079 GCAAATCACTTAACCTCTCTGGG - Intronic
964920890 3:161893869-161893891 GATAATTTCCTAATCTCTCTGGG - Intergenic
965676211 3:171199682-171199704 GTATGTTCCCTAACCACCCTGGG + Intronic
966240043 3:177745759-177745781 GTAAATAGCTTAGCCTCTCTGGG - Intergenic
966517112 3:180830103-180830125 GAAAATTCTGTAACTTCTCTGGG + Intronic
967000177 3:185326611-185326633 GTAATTTGCTTAACCTCTCTGGG - Intronic
967023731 3:185545818-185545840 ATTAATTGCCTAACCTCTCTGGG + Intronic
967192694 3:186998938-186998960 GCAAGTTACCTAACCTCTCTGGG - Intronic
967226132 3:187292986-187293008 GAAAGTTACTTAACCTCTCTGGG - Intergenic
967276246 3:187778132-187778154 GCAACTTTCTTAACCTCTCTGGG + Intergenic
967297571 3:187980106-187980128 TTACATTCTTTAACCTCTCTGGG - Intergenic
967947451 3:194815224-194815246 GCAAATCACTTAACCTCTCTCGG - Intergenic
969030560 4:4209724-4209746 GCAAATTACTTAACTTCTCTGGG - Intronic
969217727 4:5735404-5735426 GTAAGTTGCTTCACCTCTCTGGG + Intronic
969304811 4:6319515-6319537 TTAAATTACCTCATCTCTCTAGG + Intergenic
969350200 4:6593891-6593913 GAAAATTCCTTAACCTCTCTGGG - Intronic
969576332 4:8038223-8038245 GCAAGTTACCCAACCTCTCTGGG - Intronic
969586824 4:8098697-8098719 GCAAGTTCCTTAACCTCTCTGGG + Intronic
969721914 4:8896693-8896715 GTGAGTTCCCTAACCTCTCTGGG - Intergenic
969842694 4:9893951-9893973 GTAAATCCCATAATCACTCTTGG - Intronic
970258924 4:14202910-14202932 GTAAATCACCTAACTTCTCTTGG + Intergenic
970270105 4:14337363-14337385 GTAAATATCCTAACTTCTTTGGG + Intergenic
970323317 4:14897239-14897261 GCAAATTCCCTCATCTCTTTGGG - Intergenic
970387660 4:15572250-15572272 GCAAGTTACTTAACCTCTCTAGG - Intronic
970724128 4:19023568-19023590 GTAAATTCCTTGATTTCTCTAGG + Intergenic
971189921 4:24417481-24417503 GTAAATTTCACAACCTCTCTGGG + Intergenic
973222607 4:47746175-47746197 GTATATTCGCTAACTTCTCTGGG - Intronic
973645114 4:52942535-52942557 GCAAATTACCTGACTTCTCTGGG + Intronic
973839939 4:54851063-54851085 GTAAGTTACCCAACTTCTCTGGG - Intergenic
974011798 4:56613873-56613895 ATAAATTAGCTAACCTCTCTAGG + Intergenic
975656363 4:76645001-76645023 GTAAATTACTTAATCTCTCTAGG - Intronic
976276313 4:83282758-83282780 ATAAATTACTTCACCTCTCTGGG - Intronic
977085617 4:92594038-92594060 GAAAATTATTTAACCTCTCTGGG - Intronic
978187660 4:105876034-105876056 GTGAGTTACTTAACCTCTCTTGG + Intronic
978751697 4:112255906-112255928 GCAAATTACTTAACCTCCCTGGG + Intronic
980144123 4:128959976-128959998 ATCAAATGCCTAACCTCTCTGGG - Intronic
980204427 4:129699113-129699135 GAAAAGTACTTAACCTCTCTGGG + Intergenic
980327831 4:131371367-131371389 CTAAAATACCTAACCTCCCTTGG - Intergenic
981415138 4:144484044-144484066 GGAAATTCCCTAACCTAGCAAGG + Intergenic
981576464 4:146211315-146211337 GTAAATCACTTAACTTCTCTGGG - Intergenic
981874918 4:149530472-149530494 GTCAATTCTGTATCCTCTCTTGG - Intergenic
982074788 4:151727698-151727720 ACAAATTACCTTACCTCTCTAGG + Intronic
982652364 4:158102008-158102030 GCAATGTCCTTAACCTCTCTGGG + Intergenic
983733835 4:171032348-171032370 AGAAATTACTTAACCTCTCTAGG - Intergenic
984023902 4:174520306-174520328 GTAACTTACCTAAACTCTCTTGG + Intronic
984596067 4:181669320-181669342 GTAAGTTACATAACCTCTCTGGG - Intergenic
985400729 4:189590879-189590901 GTAAAATCAGTAAGCTCTCTTGG + Intergenic
987814657 5:22884540-22884562 GCAAATTCCATTAGCTCTCTAGG - Intergenic
987906698 5:24087778-24087800 GCAAGTTCCTTAGCCTCTCTGGG - Intronic
988171436 5:27662116-27662138 GTAAATCATCTAACCTGTCTTGG + Intergenic
989018806 5:36974504-36974526 GCAAATTTCTTAACCTCTGTAGG + Intronic
989051979 5:37330540-37330562 GTAAATTACTTGACTTCTCTGGG - Intronic
989359609 5:40585770-40585792 GGAAATTACCTAACCTCTCTGGG + Intergenic
989438081 5:41437953-41437975 GTACATTCCCCAGCCCCTCTTGG + Intronic
989961037 5:50415237-50415259 GTAAATTATCTAATTTCTCTTGG + Intronic
990483171 5:56231055-56231077 GCAAGTTACCTAACCTCTCTGGG - Intronic
990929745 5:61075136-61075158 GTAAATTAACTAACCTTTTTAGG - Intronic
990962076 5:61404668-61404690 GTGAAATCCCTCTCCTCTCTTGG - Intronic
990993556 5:61708460-61708482 GTTAATCCCCTAACCTATGTAGG + Intronic
991247950 5:64527506-64527528 GTCAATTCCCTGACCACTCTTGG + Intronic
991281869 5:64923502-64923524 GTCATCTCTCTAACCTCTCTCGG + Intronic
991925451 5:71701007-71701029 GCAAATTACTTAGCCTCTCTGGG + Intergenic
992247497 5:74841042-74841064 ACAAATTCCTTAACCTCTCTAGG - Intronic
992490275 5:77235952-77235974 ATAAATTACCTAATCTATCTCGG - Intronic
992908507 5:81372119-81372141 GTATTTTCCTTAACTTCTCTTGG - Intronic
993805467 5:92402925-92402947 TGAAATTCCCTTTCCTCTCTCGG + Intergenic
993944606 5:94102611-94102633 AAAATTTCCCTAACCTCACTGGG + Intronic
994998758 5:107100559-107100581 GCAAATCACTTAACCTCTCTTGG + Intergenic
995283368 5:110359265-110359287 GTAAAATAGCTAATCTCTCTGGG + Intronic
995575080 5:113521241-113521263 GAAAATTACTTAACATCTCTAGG - Intronic
995836459 5:116404670-116404692 GTAAATGCCTTAACCTCTCTGGG + Intronic
995858390 5:116617021-116617043 GCAAGTTACTTAACCTCTCTGGG + Intergenic
996422727 5:123279881-123279903 GTAAGTTCTTTAACTTCTCTCGG - Intergenic
996909837 5:128642976-128642998 GTAAATTACTTTACCTTTCTGGG + Intronic
997151901 5:131505844-131505866 GTAAATTATTTAACCTCTCTGGG + Intronic
997480436 5:134180412-134180434 GTAACTTACTTCACCTCTCTGGG + Intronic
997713187 5:136023237-136023259 GCAAATTCCTTCACCTCTCTGGG - Intergenic
997779256 5:136640538-136640560 ACAAATTACCTAATCTCTCTTGG + Intergenic
998001303 5:138628354-138628376 GCAAGTTACTTAACCTCTCTGGG - Intronic
998193427 5:140045438-140045460 GTAAGTCCCCTATCCCCTCTGGG - Intergenic
998198459 5:140097358-140097380 TTAAATTACTTAACCTCTATAGG - Intergenic
998571017 5:143258126-143258148 GTAAGTTGCCTAACTTCTCCAGG - Intergenic
998785891 5:145708355-145708377 GCAAGTTGCTTAACCTCTCTGGG + Intronic
999088550 5:148914631-148914653 GAAAATTGCTTCACCTCTCTGGG - Intergenic
999195061 5:149776273-149776295 GCAAATTCCTTTCCCTCTCTGGG + Intronic
999772097 5:154783334-154783356 GTAGTTTCCCTTGCCTCTCTGGG + Intronic
999954532 5:156686203-156686225 ATAAATTCTATAACCCCTCTAGG - Intronic
1000124210 5:158227423-158227445 AGAAATCTCCTAACCTCTCTGGG - Intergenic
1000756346 5:165165478-165165500 GCAAATTACCTTACCTTTCTGGG - Intergenic
1000772306 5:165370485-165370507 GCAATTTCTCTAACCTCTCTAGG - Intergenic
1000850215 5:166330553-166330575 GGAAATTGCCTCAACTCTCTGGG + Intergenic
1000936356 5:167306925-167306947 GTCAAGTAACTAACCTCTCTAGG - Intronic
1000947720 5:167441950-167441972 GTAAACCCCCTAAGCTTTCTGGG + Intronic
1001038789 5:168317122-168317144 GTAAGTTCCCTAACCTCTCTGGG - Intronic
1001082094 5:168674974-168674996 GTAAATCACTTAACCTCTCTGGG - Intronic
1001220556 5:169896434-169896456 GTAAATTACTTAACCTCTCTGGG + Intronic
1001294371 5:170488845-170488867 GTAAATTCTCTCCCTTCTCTGGG - Intronic
1001530038 5:172454882-172454904 GCAAGTTGCTTAACCTCTCTGGG + Intergenic
1001577847 5:172775747-172775769 ACAGATTGCCTAACCTCTCTGGG - Intergenic
1001607575 5:172973306-172973328 GCAAACTGCTTAACCTCTCTGGG + Intergenic
1001948852 5:175801937-175801959 GTTAGTTCCCTTCCCTCTCTGGG - Intronic
1002200559 5:177525409-177525431 GTAAAAACCCTACCCTCTGTGGG - Intronic
1002803249 6:547043-547065 GTCAAGTCCTTGACCTCTCTGGG + Intronic
1003105162 6:3209927-3209949 GCAAGCTCCTTAACCTCTCTGGG - Intergenic
1003309982 6:4962260-4962282 GTAAATTATATAACCTCTTTTGG - Intergenic
1003861392 6:10325258-10325280 GTAATTTACTCAACCTCTCTGGG + Intergenic
1004634471 6:17453793-17453815 GGAAATTCACTAACCTCTCCAGG + Intronic
1005160993 6:22863493-22863515 GCAAATTACTTAATCTCTCTGGG + Intergenic
1006442585 6:34061528-34061550 GTGAATTTCTTAACCTCTCTGGG - Intronic
1006716950 6:36126548-36126570 GCAAATTACATAACCTCTCCGGG + Intergenic
1006743828 6:36327409-36327431 ATAAGTTTCTTAACCTCTCTGGG + Intronic
1006814659 6:36841789-36841811 GTAAGTTACTTAGCCTCTCTGGG - Intergenic
1006907134 6:37540124-37540146 GTGAGTCACCTAACCTCTCTGGG + Intergenic
1006908504 6:37548806-37548828 GCAAGTTACCTAGCCTCTCTGGG + Intergenic
1007695756 6:43733499-43733521 TTAAGTTCCTTAACCACTCTGGG + Intergenic
1007723450 6:43900022-43900044 GCAAGTTACCTAACCTTTCTGGG - Intergenic
1007970922 6:46051331-46051353 GCAAATTACTTAACCTCTCTGGG + Intronic
1008395030 6:50996149-50996171 GCAAATTAATTAACCTCTCTGGG + Intergenic
1010498422 6:76565199-76565221 GCAAATTACCTAACATCTCTGGG - Intergenic
1011011692 6:82710630-82710652 GACAATTACTTAACCTCTCTGGG + Intergenic
1011098392 6:83693215-83693237 ATAAATTCCTTAACCTCCTTGGG + Intronic
1011174585 6:84545952-84545974 GCAAATTACTTTACCTCTCTTGG + Intergenic
1011654025 6:89533291-89533313 GACAAGTCCCTAACCTCTCCGGG - Intronic
1011701606 6:89960294-89960316 GTAAATCCCTTCACCTTTCTGGG - Intronic
1012324104 6:97892975-97892997 GGAAATTGCTTAACCTCTTTAGG - Intergenic
1012506036 6:99947403-99947425 GCAAATCTCCTCACCTCTCTGGG + Intronic
1012574479 6:100775411-100775433 GTAAGTTATTTAACCTCTCTAGG - Intronic
1013284174 6:108666273-108666295 GCAAACTACTTAACCTCTCTGGG - Intronic
1013624745 6:111925912-111925934 GTAAGTTGCCTAATTTCTCTGGG + Intergenic
1014607690 6:123498196-123498218 TTAAATTCAATAAACTCTCTTGG - Intronic
1014967910 6:127779739-127779761 AAAAATTTCATAACCTCTCTTGG + Intronic
1015133760 6:129844429-129844451 GCAAGTCACCTAACCTCTCTGGG + Intronic
1015294460 6:131574854-131574876 GCACATTACCAAACCTCTCTGGG - Intronic
1015362857 6:132360285-132360307 GCAAATTACTTAACCTTTCTGGG + Intronic
1015418047 6:132972439-132972461 GAAAATTACTTAAGCTCTCTGGG - Intergenic
1015929267 6:138340685-138340707 GCAAATTTCTTAACCTCTCTGGG - Exonic
1016700858 6:147052604-147052626 GCAAATTTCTTAACTTCTCTAGG + Intergenic
1017131751 6:151113824-151113846 GCAAAATACTTAACCTCTCTGGG + Intergenic
1018068295 6:160139213-160139235 GGAAGTTAACTAACCTCTCTGGG - Intronic
1018256405 6:161924056-161924078 GGAAGTTACTTAACCTCTCTGGG + Intronic
1018325957 6:162669016-162669038 GCAAATTGTTTAACCTCTCTAGG - Intronic
1019767155 7:2860102-2860124 GCAAATTCCTTAACCTCACTGGG - Intergenic
1020026298 7:4902426-4902448 GAAAATCACCAAACCTCTCTGGG + Intergenic
1020031318 7:4934810-4934832 GAAAATTGCTTAACGTCTCTGGG + Intronic
1020816488 7:12912062-12912084 GCAAGTAACCTAACCTCTCTGGG - Intergenic
1021807008 7:24367625-24367647 GCAAGTTCCTTACCCTCTCTGGG + Intergenic
1022062447 7:26811242-26811264 GCAAATCACCTAATCTCTCTGGG + Intronic
1022111726 7:27236209-27236231 GCAAATTCCTCAACCTCTCGGGG + Intergenic
1022113641 7:27245696-27245718 GTCACTCCCCAAACCTCTCTCGG + Intronic
1022221790 7:28321021-28321043 GCAAATTACCTGACCTCTCTGGG + Intronic
1022396339 7:29990283-29990305 GCAAGTTACTTAACCTCTCTAGG - Exonic
1023121196 7:36910622-36910644 GCAAATTCCTAAACCTCTCTAGG + Intronic
1024064461 7:45720923-45720945 CTCAAGTCCCCAACCTCTCTGGG - Exonic
1024088768 7:45918773-45918795 GGAAAGTCCCTCTCCTCTCTGGG + Intronic
1025251359 7:57353493-57353515 GCAAATTACCTGGCCTCTCTGGG + Intergenic
1026522251 7:71127725-71127747 GCAAATTACCTCACTTCTCTGGG - Intergenic
1028674103 7:93438813-93438835 GTACATTCCCTACCTTCTGTAGG + Intronic
1028891221 7:95990629-95990651 GCAAATTGCCTAACTTCTCTTGG + Intronic
1028948668 7:96609513-96609535 GGAAATTCTCTAACTTCTCTGGG - Intronic
1028952383 7:96651134-96651156 ATAAATTCCCTAAACTTTGTAGG + Intronic
1029332929 7:99874900-99874922 GTAAGTTACTTAACCTCTCAAGG - Intergenic
1029371974 7:100156080-100156102 ATAAGTTACTTAACCTCTCTGGG - Intronic
1029991299 7:104965050-104965072 GCAAGTTACTTAACCTCTCTAGG + Intergenic
1030009991 7:105156284-105156306 GCAAGTTACTTAACCTCTCTGGG + Intronic
1030116163 7:106063882-106063904 GGCAATTGCCCAACCTCTCTGGG + Intergenic
1030130635 7:106196589-106196611 ACAAGTTCCTTAACCTCTCTGGG - Intergenic
1030852921 7:114513124-114513146 TTAAATTACTCAACCTCTCTAGG + Intronic
1031798524 7:126211018-126211040 ACAAATTACATAACCTCTCTGGG + Intergenic
1031998400 7:128247849-128247871 GGAAAGTGGCTAACCTCTCTGGG - Intronic
1032132110 7:129238518-129238540 CTACATTCCCTATCCTCTCCTGG - Intronic
1032500244 7:132394601-132394623 GTAAATTCCTTCACCTCTCTGGG + Intronic
1033282845 7:140017952-140017974 GCAAGCTCCTTAACCTCTCTCGG + Intronic
1033302964 7:140202497-140202519 GCAAATTATCTAACTTCTCTGGG + Intergenic
1033367101 7:140680065-140680087 GCAAGTTGCTTAACCTCTCTGGG + Intronic
1033416438 7:141165798-141165820 GAAAATTACTTAACTTCTCTGGG + Intronic
1034051543 7:147989328-147989350 ACAAGTTCCTTAACCTCTCTGGG + Intronic
1034752804 7:153586735-153586757 GTAAATTACTTAACCTCTCTGGG + Intergenic
1034787690 7:153940525-153940547 GTAAATCAGCTCACCTCTCTGGG - Intronic
1035931487 8:3785133-3785155 GTAAGTTCTTTAACTTCTCTTGG + Intronic
1037439917 8:18904727-18904749 GTAAATACCTTAACCTTTCTGGG + Intronic
1037523372 8:19701742-19701764 GTAAATTACTTAAACTTTCTGGG - Intronic
1037580134 8:20240237-20240259 ATAAATTGCTTAAACTCTCTGGG - Intergenic
1037707185 8:21325209-21325231 GCAAATTACTTAACCTCTCCGGG + Intergenic
1037885230 8:22592510-22592532 GCAAATCCCTTAACCTCTCTGGG + Intronic
1037924856 8:22836113-22836135 GCAAGTTGCCTAAACTCTCTGGG + Intronic
1038015115 8:23508239-23508261 ATAAATTCCTCCACCTCTCTGGG - Intergenic
1038260127 8:25985530-25985552 GTAAGTCACTTAACCTCTCTGGG + Intronic
1038547791 8:28439241-28439263 ATAAGTTACTTAACCTCTCTAGG - Intronic
1038778300 8:30550323-30550345 GCAAGTTTCTTAACCTCTCTGGG + Intronic
1039439902 8:37587980-37588002 GCAAATCCCCTCGCCTCTCTGGG - Intergenic
1039452898 8:37689891-37689913 GCAAGTTGCTTAACCTCTCTGGG + Intergenic
1043480068 8:80643837-80643859 ATAAATCTCTTAACCTCTCTAGG - Intronic
1044672772 8:94700060-94700082 GTAAGTTGCCTAACCTCTCTGGG - Intronic
1044968571 8:97597433-97597455 GGAATTTTCTTAACCTCTCTAGG + Intergenic
1045177057 8:99736917-99736939 GAAAATTATTTAACCTCTCTGGG - Intronic
1045697098 8:104821655-104821677 AAAACTTACCTAACCTCTCTGGG - Intronic
1046840203 8:118847701-118847723 GTAACTTACCTAACATCTTTAGG + Intergenic
1047960605 8:130009086-130009108 GCACATTGCATAACCTCTCTTGG - Intronic
1048200924 8:132373264-132373286 GTAAGTCACTTAACCTCTCTGGG + Intronic
1048228304 8:132612150-132612172 CCACATTCCTTAACCTCTCTAGG + Intronic
1048574603 8:135680860-135680882 GTAAGTTCCTGAAACTCTCTGGG - Intergenic
1050106327 9:2170201-2170223 GTGGATTTCCTAACCTTTCTGGG - Intronic
1050799619 9:9593625-9593647 GCAAATTCACTAAGCTCTCATGG - Intronic
1051525995 9:18045083-18045105 GTGACTTCCATGACCTCTCTGGG + Intergenic
1051696577 9:19774323-19774345 ATACATTACTTAACCTCTCTGGG - Intronic
1052220355 9:26014454-26014476 GTAATTCCCCTAACATCTCAAGG - Intergenic
1052460372 9:28755354-28755376 GCAAACTACTTAACCTCTCTGGG + Intergenic
1055499182 9:76886281-76886303 GTATGTTCCTTAACCTCTTTGGG - Intronic
1055672216 9:78618976-78618998 GCAAATTACTTAACTTCTCTGGG + Intergenic
1056271632 9:84953436-84953458 GTGAGTTACATAACCTCTCTGGG - Intronic
1056796756 9:89663798-89663820 GAAAAGTCCTTAACTTCTCTGGG + Intergenic
1056957968 9:91097614-91097636 GTACATTACCTGACCTCACTGGG + Intergenic
1057803437 9:98203861-98203883 GCAAGTACACTAACCTCTCTGGG + Intronic
1057936247 9:99241537-99241559 GCAAATTCCTTCCCCTCTCTGGG - Intergenic
1058554743 9:106155013-106155035 GCAAGTCCCCTAGCCTCTCTTGG + Intergenic
1058569164 9:106322442-106322464 GCAATTTACTTAACCTCTCTGGG + Intergenic
1059410044 9:114126035-114126057 GCAAGTTACTTAACCTCTCTGGG + Intergenic
1059429079 9:114239438-114239460 GCAAGTTCCTTAGCCTCTCTGGG - Intronic
1059463702 9:114451857-114451879 GCAAGTTACTTAACCTCTCTGGG + Intronic
1060047414 9:120351693-120351715 GCAAGTTCCTTAAACTCTCTGGG - Intergenic
1060090174 9:120735664-120735686 GCAAATTTCCTAACATCTCGAGG + Intergenic
1060198245 9:121636910-121636932 GCAAGTTCCCTAACCTCTCTGGG - Intronic
1060548933 9:124476196-124476218 GCAAGTTCCCTTCCCTCTCTGGG + Intronic
1061247255 9:129406892-129406914 GCAAATTATTTAACCTCTCTTGG + Intergenic
1061249985 9:129420899-129420921 GCAACTCACCTAACCTCTCTGGG + Intergenic
1061780360 9:132992454-132992476 GTGAGTTCCTGAACCTCTCTGGG + Intergenic
1062734155 9:138126137-138126159 GCAACTCGCCTAACCTCTCTGGG + Intergenic
1187238088 X:17487205-17487227 GCAAGTTCCTTAACCTCTCTGGG - Intronic
1187239978 X:17503524-17503546 GTAAGTTACCTGACCTCTCTGGG - Intronic
1187769938 X:22683841-22683863 GTAAGTTACATAACTTCTCTTGG + Intergenic
1187913765 X:24134107-24134129 GTAAGTTACCTAACTTCTTTGGG + Intergenic
1189188636 X:39075887-39075909 GTAAATTGACTAGCCCCTCTGGG + Intergenic
1189194939 X:39144923-39144945 GGATGTTCCTTAACCTCTCTGGG + Intergenic
1189346722 X:40247546-40247568 GTAAATTAATTAACCTCTCTGGG + Intergenic
1189507597 X:41627665-41627687 GTAAATCATTTAACCTCTCTAGG + Intronic
1189557123 X:42156396-42156418 AGAAATTACTTAACCTCTCTGGG - Intergenic
1189613828 X:42764796-42764818 GGAAACTCCCTCACCTCTCTGGG + Intergenic
1192054782 X:67761886-67761908 GCAAATTCCTTAACATCTCTGGG + Intergenic
1192077378 X:68013322-68013344 GTAAGTTTCTTAACCTCTCTAGG - Intergenic
1192203271 X:69080763-69080785 GCTAATTCCTTCACCTCTCTGGG + Intergenic
1192238055 X:69308572-69308594 GCAAGTTTCTTAACCTCTCTGGG - Intergenic
1195588853 X:106600625-106600647 GTAAGTTACCTAAACTCTCTAGG - Intergenic
1195867682 X:109450930-109450952 GTAAGCCCCCTAACCTTTCTTGG - Intronic
1196820819 X:119698934-119698956 ATACCTTCCCTCACCTCTCTGGG - Intergenic
1197541116 X:127762912-127762934 ATAAATACCTGAACCTCTCTGGG - Intergenic
1198401004 X:136268213-136268235 GCAGATTCGTTAACCTCTCTAGG - Intergenic
1199037381 X:143068227-143068249 GAAAATTCCCTATTCTCTCTGGG + Intergenic
1199538599 X:148932055-148932077 GTCAATTCCCTTTCCTCTCTGGG + Intronic
1199759569 X:150895020-150895042 TTAAGTTCCTAAACCTCTCTGGG + Intronic
1199784452 X:151091871-151091893 GAAAACTCCATAACCTCTCAGGG - Intergenic
1200069451 X:153520654-153520676 GCAAGTTACCTAGCCTCTCTGGG - Intronic
1200300545 X:154970284-154970306 GCAAATTAATTAACCTCTCTGGG - Intronic