ID: 1138069073

View in Genome Browser
Species Human (GRCh38)
Location 16:53972711-53972733
Sequence TTCAATCAGCTCTACATTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 234}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138069071_1138069073 3 Left 1138069071 16:53972685-53972707 CCAGAGGCTGTGCATACTGCCTA 0: 1
1: 0
2: 0
3: 10
4: 131
Right 1138069073 16:53972711-53972733 TTCAATCAGCTCTACATTTTAGG 0: 1
1: 0
2: 1
3: 21
4: 234
1138069070_1138069073 4 Left 1138069070 16:53972684-53972706 CCCAGAGGCTGTGCATACTGCCT 0: 1
1: 0
2: 1
3: 16
4: 246
Right 1138069073 16:53972711-53972733 TTCAATCAGCTCTACATTTTAGG 0: 1
1: 0
2: 1
3: 21
4: 234
1138069069_1138069073 15 Left 1138069069 16:53972673-53972695 CCTGCGTGGTTCCCAGAGGCTGT 0: 1
1: 0
2: 1
3: 12
4: 166
Right 1138069073 16:53972711-53972733 TTCAATCAGCTCTACATTTTAGG 0: 1
1: 0
2: 1
3: 21
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138069073 Original CRISPR TTCAATCAGCTCTACATTTT AGG Intronic
901158422 1:7155895-7155917 TTCATTCAGTTCCACATTTATGG + Intronic
903478626 1:23637507-23637529 ATCCATCAGCTCTAGAGTTTGGG + Intronic
905537188 1:38731544-38731566 TTTAAAGACCTCTACATTTTAGG - Intergenic
907591739 1:55680238-55680260 TTCCAGCTGCTCTACACTTTTGG + Intergenic
908663061 1:66458902-66458924 TTCAATCTTATCTACACTTTTGG + Intergenic
910652280 1:89582486-89582508 CTTAATCAGCTCTTCCTTTTAGG + Intronic
911303427 1:96204198-96204220 TGCAATCTACTCTATATTTTGGG + Intergenic
912043887 1:105428954-105428976 TTCAAACACCTCTATAATTTTGG - Intergenic
912215144 1:107601379-107601401 TTGAAGCAGTTCTACATTTTTGG + Intronic
913042841 1:115045081-115045103 TTGAATTAGCTCTTCAATTTTGG - Intergenic
913142790 1:115957921-115957943 TTCTATCATCTCTTCATTTCTGG - Intergenic
913150920 1:116042206-116042228 TTCTATCATCTGTGCATTTTTGG - Intronic
913278512 1:117162788-117162810 TTCAATCAGCGCTCCGTTGTAGG + Intronic
915289661 1:154874881-154874903 TTCAGTTAGTTCTACCTTTTGGG - Intergenic
917708707 1:177661129-177661151 TTATTTCAACTCTACATTTTTGG - Intergenic
919537234 1:198802894-198802916 TTTAATAAGCTACACATTTTAGG + Intergenic
922606987 1:226895559-226895581 TCCCATCAGCTCTACATCTGAGG + Exonic
923419201 1:233795973-233795995 AACAATCAGCTGTACATTTTGGG + Intergenic
923822808 1:237464770-237464792 TTCAATTAATTCTACATTGTGGG + Intronic
924730062 1:246702922-246702944 TTCAATGATTTCTACATTTCAGG + Intergenic
1063355380 10:5394075-5394097 TTCAATTAGGTCTACATTCAAGG + Exonic
1063852294 10:10206809-10206831 TTCAATGGGCACTCCATTTTAGG + Intergenic
1064698541 10:17992693-17992715 CTGAATAAACTCTACATTTTTGG - Intronic
1065578279 10:27146079-27146101 TCCAATCAGTTCTACACTGTTGG - Intronic
1068148321 10:53099371-53099393 TTCTATCAGCTCAGCATTTTAGG + Intergenic
1068782860 10:60940585-60940607 TTCAAACAGCTCACAATTTTGGG + Intronic
1068881959 10:62059401-62059423 TTCAAATGGCTCTACACTTTTGG + Intronic
1072037895 10:91581031-91581053 TTCAAAGAGCTATACATCTTTGG - Intergenic
1075016408 10:118912877-118912899 TTAAATTATCTCAACATTTTTGG + Intergenic
1075162124 10:120033625-120033647 CCCAATCAGCTCTGCGTTTTGGG - Intergenic
1075422401 10:122311686-122311708 TTCATTGAGCTCTTCATTTAAGG - Intronic
1075553470 10:123411627-123411649 TTTCATCAGCTGTACATTTAGGG + Intergenic
1082638119 11:55621453-55621475 TTGAATCAGCTTTGCATTCTAGG + Intergenic
1083141006 11:60721803-60721825 TTCAACCATCACTACATTTATGG - Intergenic
1088180168 11:107100580-107100602 TTAAATCAACTCTACATTTCTGG - Intergenic
1091401569 12:184129-184151 TTCAATCATCTGTTCATTCTTGG - Intergenic
1093703385 12:22248093-22248115 TGCAATCAGCTTTTAATTTTGGG - Intronic
1094665141 12:32512660-32512682 TCCAATCAACTCTGCATTTCAGG - Intronic
1095555773 12:43502099-43502121 TTCATTAAGCTAAACATTTTAGG + Intronic
1097578575 12:61425787-61425809 TTCAATCTCCTCTTGATTTTCGG + Intergenic
1098550903 12:71760213-71760235 TTCACTGAGATCTACATTTCCGG + Intronic
1099477817 12:83129171-83129193 TTTAAGCAGCTATACATTTCAGG - Intronic
1100802881 12:98251863-98251885 TACAGTCAGCTCTCTATTTTGGG + Intergenic
1101606458 12:106250335-106250357 TTCAAGCAGTTCTCCATGTTAGG + Intronic
1104354647 12:128074785-128074807 TTTCAGCAGCTCTACATTTTGGG + Intergenic
1105573023 13:21622201-21622223 CTCAGTCAACTCTTCATTTTTGG - Intergenic
1106682280 13:32020184-32020206 TTCAATTAGCATAACATTTTGGG + Intergenic
1109517879 13:63467948-63467970 GTCAAACAGCTGTACAATTTAGG + Intergenic
1110047024 13:70843565-70843587 TTCAGTGAGCTTTTCATTTTCGG - Intergenic
1110899717 13:80806046-80806068 TTCTATGAGTTCAACATTTTTGG - Intergenic
1113140393 13:107141739-107141761 TTCAATCAGCACTACTTTTGAGG - Intergenic
1113405011 13:110030980-110031002 TTCCCTCAGCTCTCCATGTTGGG - Intergenic
1114280286 14:21187908-21187930 TTAAATCAACTTTATATTTTTGG - Intergenic
1115622072 14:35150465-35150487 TTCTAGAAGCTTTACATTTTTGG - Intronic
1115937496 14:38570030-38570052 TTGAATCTGCCCTACATCTTGGG - Intergenic
1118897595 14:69958650-69958672 TTCAATCGTGTCCACATTTTGGG + Intronic
1120268837 14:82284715-82284737 TTCATTAAACTCTGCATTTTAGG - Intergenic
1121867206 14:97373709-97373731 TCCAACCAGCTCTAAAATTTAGG - Intergenic
1121965070 14:98296326-98296348 TTCATTCATCTATCCATTTTTGG + Intergenic
1202829302 14_GL000009v2_random:9296-9318 TTCAATGATCTCTAATTTTTAGG + Intergenic
1125060986 15:35423650-35423672 TTCAAGGAGTTTTACATTTTTGG + Intronic
1127041004 15:54976721-54976743 TTCAATCCTGTCTGCATTTTTGG - Intergenic
1131772683 15:95757169-95757191 TTCAATCATCTCAAAAATTTAGG + Intergenic
1138069073 16:53972711-53972733 TTCAATCAGCTCTACATTTTAGG + Intronic
1138876949 16:60963677-60963699 TTCAACCAGCTCTATATAATTGG + Intergenic
1140222181 16:73051768-73051790 TTAAAACAGCTTTACATGTTAGG + Intronic
1140618667 16:76699666-76699688 TTAAATCAGCTTTGCATTTATGG - Intergenic
1140651043 16:77088964-77088986 TTCTAGCAGCTTTACCTTTTGGG + Intergenic
1146726070 17:35157118-35157140 ATCAATCAGCTCTATATTATTGG + Intronic
1148816187 17:50329799-50329821 GTCCATCAGCTCTACAGGTTGGG + Intergenic
1151747264 17:76018258-76018280 TTCAATCTCCTCTTCATTCTAGG - Exonic
1153412127 18:4805045-4805067 ATGAATCAGCTTTACATATTGGG - Intergenic
1154417962 18:14195312-14195334 TTCAATGATCTCTAATTTTTAGG + Intergenic
1155770970 18:29698139-29698161 TACATTCAGCTATACATTTAGGG + Intergenic
1155961322 18:31997809-31997831 TTGAATCAACTCCACATTTGGGG - Intergenic
1156105401 18:33653385-33653407 ATCCAACAGCTCTGCATTTTAGG + Intronic
1156768081 18:40683650-40683672 TTTTATCAGTTCTATATTTTAGG + Intergenic
1157438145 18:47688826-47688848 ATGAGTTAGCTCTACATTTTGGG - Intergenic
1157733881 18:50029499-50029521 TTCAGTCAGCCCTGAATTTTGGG - Intronic
1158103645 18:53859866-53859888 TTCAATTATTTCTACATCTTCGG + Intergenic
1159348959 18:67246046-67246068 TTCAATTATTTCTACATTCTAGG + Intergenic
1163087818 19:14995006-14995028 TTCTATGAGTTCAACATTTTAGG - Intronic
1163821686 19:19499742-19499764 TACAAGCAACTCTACATTTGAGG - Intronic
1168375471 19:55874939-55874961 TTAAAGCAACTTTACATTTTGGG - Intronic
1202643390 1_KI270706v1_random:118486-118508 TTCAATGATCTCTAATTTTTAGG - Intergenic
925606233 2:5663318-5663340 TTCTATCAGGTGTACATTTTGGG - Intergenic
929650208 2:43671993-43672015 TTCATTCTTCTATACATTTTTGG + Intronic
929694543 2:44102954-44102976 TTCAATCATCTCTTCCTTTCTGG + Intergenic
929791478 2:45026245-45026267 TCCATTCTGCTCTACTTTTTGGG + Intergenic
931529164 2:63193232-63193254 TTTAATAAGCTTTACATTTTAGG + Intronic
931589334 2:63864732-63864754 TTCCATCAGTTCTCCATCTTTGG + Intronic
932879849 2:75491186-75491208 TTCAACCAATTCCACATTTTAGG - Intronic
934499283 2:94841978-94842000 TTCAATGATCTCTAATTTTTAGG - Intergenic
935851686 2:107228559-107228581 TTCATCAAGCTCTACATTTATGG - Intergenic
935946123 2:108288336-108288358 TTCTATCCTCTCTGCATTTTCGG + Intergenic
936628156 2:114171034-114171056 TTCACTCAGCTATACACCTTTGG - Intergenic
936988186 2:118332081-118332103 TTCATTTTGCTCTGCATTTTTGG - Intergenic
938803091 2:134780981-134781003 TCCCATTAGTTCTACATTTTTGG - Intergenic
941009220 2:160279608-160279630 TTCAATGAACTCTTTATTTTTGG + Intronic
941035436 2:160563388-160563410 ATCAAGTAGATCTACATTTTTGG - Intergenic
942625295 2:177894027-177894049 TTCCATCATCTGTACATTTTTGG - Intronic
945032821 2:205681693-205681715 TTCAAGCACCTATACTTTTTCGG + Intergenic
948872197 2:240807602-240807624 TTCAACCAGATCAAAATTTTTGG - Intronic
949073879 2:242042795-242042817 TTCCATCAGGGCTGCATTTTGGG - Intergenic
1169997054 20:11570369-11570391 TTCATTCTGCCCTACATTATTGG + Intergenic
1170075888 20:12418570-12418592 GTCAATTACTTCTACATTTTTGG + Intergenic
1170186113 20:13593191-13593213 TTTAATCAGCCCTGCATTTCTGG - Intronic
1170520277 20:17178125-17178147 TTTAATCAGCTCTCCATTGATGG + Intergenic
1171890511 20:30708688-30708710 TTCAATGATCTCTAATTTTTAGG - Intergenic
1173712800 20:45175444-45175466 CTCACTCATTTCTACATTTTTGG - Intronic
1174860288 20:54084949-54084971 ATATATAAGCTCTACATTTTGGG + Intergenic
1176608486 21:8854136-8854158 TTCAATGATCTCTAATTTTTAGG + Intergenic
1176855335 21:13963963-13963985 TTCAATGATCTCTAATTTTTAGG - Intergenic
1177500271 21:21945583-21945605 TTCAATAAATTGTACATTTTAGG - Intergenic
1178220449 21:30651867-30651889 TTCAACCAGATGTACATTTGTGG - Intergenic
1178614586 21:34120346-34120368 TTCATACAGCTGTATATTTTTGG + Intronic
1179265365 21:39798140-39798162 TTTAAGCAGCTCTGCTTTTTAGG + Intronic
1179962595 21:44777920-44777942 TTCAATCTGGTCTAAATCTTAGG + Intronic
1180358571 22:11863950-11863972 TTCAATGATCTCTAATTTTTAGG + Intergenic
1180379695 22:12128382-12128404 TTCAATGATCTCTAATTTTTAGG - Intergenic
1180657923 22:17439815-17439837 TTCACTCTGTTCTCCATTTTAGG - Intronic
1180661353 22:17470063-17470085 TTCAATCAGCTCAGCATCTTAGG - Intronic
1182500812 22:30746025-30746047 TTCAATGACCTCTTCATTGTAGG - Intronic
955447076 3:59023939-59023961 TTCAATCTTATGTACATTTTGGG - Intronic
956168163 3:66412225-66412247 TAAGATGAGCTCTACATTTTTGG + Intronic
956429580 3:69172092-69172114 TTCCCTTATCTCTACATTTTGGG - Intronic
959313827 3:104776745-104776767 TTCAATCACCTCTAGATTGCTGG - Intergenic
959716547 3:109439796-109439818 TTTAATCAGCTTAACATTTTGGG + Intergenic
959832429 3:110880595-110880617 CACAGTAAGCTCTACATTTTTGG - Intergenic
960765104 3:121118611-121118633 CTCAATCAAATCTATATTTTAGG + Intronic
961367835 3:126412624-126412646 TTCAACCAACTCTGCATTTTTGG + Intronic
961991816 3:131200078-131200100 TTCAAGAATCTCTACATCTTTGG - Intronic
962925450 3:139989034-139989056 TTCAATCTGCTTTACAATTTGGG + Intronic
964145638 3:153459266-153459288 TTCTATGAGATCAACATTTTAGG - Intergenic
965553150 3:169991026-169991048 ATCACTCAGCTCTACATAATTGG + Intronic
965666584 3:171100549-171100571 TTCAATCACCTCTATTTCTTTGG - Intronic
966003293 3:174977178-174977200 TTCTATGAGTTCAACATTTTTGG - Intronic
968893231 4:3383651-3383673 TTCAAACAGCTTTAAATTTATGG - Intronic
975032095 4:69633899-69633921 TTCAATGAGCTATAAAGTTTAGG + Intronic
976597314 4:86906286-86906308 TTCAATCTACTCTACATTAAAGG - Intronic
977456294 4:97264783-97264805 TTCAACCTGATCTATATTTTAGG - Intronic
979350612 4:119640589-119640611 TCAAGTCAGCTCTCCATTTTTGG + Intergenic
980345868 4:131618556-131618578 TTCAAGCAGGTCTAGATATTTGG - Intergenic
980431138 4:132697835-132697857 TTAAATCAACTTTACATTATTGG - Intergenic
980525415 4:133985366-133985388 TTCAATCAGATATGCACTTTGGG + Intergenic
981420254 4:144541981-144542003 TTTAATCAGCTTTACATCTTGGG - Intergenic
981897527 4:149820762-149820784 TCCAGTCAGCTTTTCATTTTCGG - Intergenic
984124828 4:175795213-175795235 TTGAATCAACTCTACATCCTTGG - Intronic
1202770763 4_GL000008v2_random:204397-204419 TTCAATGATCTCTAATTTTTAGG - Intergenic
986414630 5:7516257-7516279 TTCAATCAACTATACATCATGGG - Intronic
986764183 5:10908805-10908827 TTCAATCAGCACTGAATTTGTGG + Intergenic
986867470 5:12007070-12007092 TTCAATAAAATCTCCATTTTTGG + Intergenic
986930304 5:12810407-12810429 CTCAGCCAGCACTACATTTTAGG + Intergenic
987259836 5:16192365-16192387 TTCAGATACCTCTACATTTTGGG - Intergenic
987833604 5:23132115-23132137 TTCACTCAGCGTTTCATTTTTGG + Intergenic
987865623 5:23532524-23532546 TTCATTTATCTCTACATTTTCGG + Intergenic
988238663 5:28579187-28579209 TTGAATCAGCTTTGCATTCTAGG - Intergenic
989728288 5:44615712-44615734 CTCAATCAGCTCTGCTTTTAAGG - Intergenic
990131174 5:52586600-52586622 TTAAATCAGCTTTACAATTTTGG - Intergenic
990139980 5:52691957-52691979 TTAAATTATCTCTACTTTTTTGG + Intergenic
994917370 5:105997827-105997849 TTATATGAGTTCTACATTTTTGG + Intergenic
995403162 5:111764280-111764302 TTCAATCAGCCCTTTCTTTTTGG - Intronic
995856226 5:116595359-116595381 TACACTCTGCACTACATTTTTGG - Intergenic
995977140 5:118053044-118053066 TTCAATCAGATTGACATGTTTGG - Intergenic
996255738 5:121401427-121401449 TTCCATAATCTCTACATTTTTGG + Intergenic
996602499 5:125281120-125281142 TTCAGTCAGCTCTATATCTCTGG + Intergenic
997046563 5:130326108-130326130 TTCTGTCAAATCTACATTTTAGG - Intergenic
997085940 5:130798662-130798684 TTCTTTCATCTCTACCTTTTAGG + Intergenic
997350215 5:133225657-133225679 TCCAAACAGCTCTCCCTTTTAGG - Exonic
997401297 5:133605083-133605105 TCCAATAAGCTGTACTTTTTTGG + Intronic
997637625 5:135425953-135425975 TTCTAACAGCTCTACGTGTTTGG + Intergenic
998051833 5:139042365-139042387 TTCAAACAGCTCCCCATGTTTGG - Intronic
998580371 5:143367880-143367902 TTAAATCAACTCTCCATTTCTGG - Intronic
999654466 5:153798753-153798775 ATGAATCAGCCCTACATTCTTGG + Intronic
1000760311 5:165215522-165215544 ATTCATCAGCTCTATATTTTGGG + Intergenic
1000817940 5:165946736-165946758 TTCAATGACCTGTACAATTTAGG - Intergenic
1001095192 5:168770612-168770634 TCCAAACATCTCTACTTTTTAGG + Intronic
1003508559 6:6760120-6760142 TACAATCTGCTATACGTTTTTGG - Intergenic
1003663836 6:8090092-8090114 TTAAATCAGATTTGCATTTTTGG - Intronic
1004689257 6:17977489-17977511 TTTAATCATTTCTATATTTTTGG - Intronic
1005134441 6:22551711-22551733 TTCAGACAGCTCTACATTTCAGG - Intergenic
1006777409 6:36606325-36606347 TCCCCTTAGCTCTACATTTTGGG - Intergenic
1008326492 6:50188002-50188024 TTGATTTAGCTCTCCATTTTTGG - Intergenic
1008531146 6:52460496-52460518 TACAATAAGCTGCACATTTTTGG - Intronic
1008655701 6:53611364-53611386 TCCAATTTGCTCTACATTTATGG + Intronic
1009294449 6:61927846-61927868 TTCAATCAGCTATAAAATTGTGG + Intronic
1011047714 6:83104390-83104412 TTCAATCAACCCTTCATTTCTGG + Intronic
1014755205 6:125295272-125295294 TTCATTCAGCTCGGCACTTTAGG - Intronic
1015483070 6:133736362-133736384 TTCAATCTCCTCTAAAATTTTGG + Intergenic
1016726753 6:147379554-147379576 TAGAATTAGCTATACATTTTTGG - Intronic
1017017416 6:150113018-150113040 TTGTTTCAGTTCTACATTTTTGG + Intergenic
1017829272 6:158110945-158110967 TTCATTCTTCTCTCCATTTTAGG + Exonic
1018654869 6:166025388-166025410 TGCAATCAGCTCTCCACTTCGGG - Intergenic
1018745557 6:166759015-166759037 TTTAATCAGCTCTGCATTCAAGG - Intronic
1018776864 6:167025182-167025204 TTAAATCATCTCTCCTTTTTTGG + Intronic
1019020416 6:168913292-168913314 TGAAATCAGTTCAACATTTTTGG + Intergenic
1021516512 7:21493971-21493993 TTCAAACAGCTTTTCATTCTTGG - Intronic
1023306477 7:38833979-38834001 TTAAATCAGCTTTGTATTTTTGG - Intronic
1023485039 7:40677222-40677244 TTCGGCCAACTCTACATTTTAGG + Intronic
1023679461 7:42670191-42670213 TTAAATCAGTCCTACATTTCTGG - Intergenic
1024269603 7:47632428-47632450 TTCAATCAGATGAATATTTTAGG + Intergenic
1027671989 7:81112284-81112306 TTCAGTTAGCTCTAGATGTTTGG - Intergenic
1027846488 7:83383986-83384008 TGCAATATGCTGTACATTTTTGG + Intronic
1027857904 7:83536393-83536415 TACAATTACCTATACATTTTAGG + Intronic
1028024378 7:85819300-85819322 TTCAGTCAACTCTTCATTCTTGG - Intergenic
1029504866 7:100957074-100957096 TTCAATCACCTCCACATATACGG + Exonic
1029818637 7:103123367-103123389 TTCAATCAGTTCTTAAATTTGGG + Intronic
1031230855 7:119103917-119103939 GTGAATGAGCTCTAGATTTTTGG + Intergenic
1033110425 7:138569304-138569326 TTCATTCATGTTTACATTTTTGG - Intronic
1033849584 7:145479275-145479297 TTAAATCACTTTTACATTTTAGG + Intergenic
1034291471 7:149935779-149935801 TTTTATGACCTCTACATTTTTGG + Intergenic
1034814627 7:154161115-154161137 TTTTATGACCTCTACATTTTTGG - Intronic
1037508817 8:19561259-19561281 TTCATTAACCTCTACATTTATGG + Intronic
1037540781 8:19868497-19868519 TTCAATCAGCCCTTCATTTTTGG - Intergenic
1038148794 8:24923585-24923607 TTCAATAAGGTATTCATTTTAGG + Intergenic
1040964074 8:53066547-53066569 GTCAATTAGCTCTAGGTTTTTGG - Intergenic
1041541628 8:58991416-58991438 ATTAATCTGCTATACATTTTGGG - Intronic
1042285016 8:67099577-67099599 TTCAATCATCTCAACATTAAAGG - Intronic
1042949308 8:74184730-74184752 TTCACTCTGCTGTACATATTTGG + Intergenic
1043351510 8:79366569-79366591 TTGGATCACATCTACATTTTAGG - Intergenic
1043959163 8:86395947-86395969 TTCAAACAGCTATATATTTTAGG + Intronic
1043959798 8:86404299-86404321 TTCCATCAGCTGAATATTTTAGG - Intronic
1046856982 8:119043478-119043500 TTCAAGAAACTCTACAGTTTTGG - Intronic
1048356543 8:133658381-133658403 TGGAATCTGGTCTACATTTTAGG - Intergenic
1051088895 9:13383463-13383485 TACATTCATCTCTACATTTTTGG + Intergenic
1051949402 9:22612927-22612949 TGCACTCAGCTTTATATTTTTGG - Intergenic
1051976383 9:22954854-22954876 TTGAACCAGCTTTACATTCTTGG - Intergenic
1052291818 9:26850357-26850379 TTCAAAGATCTCGACATTTTTGG - Intronic
1053065331 9:35064727-35064749 TTCAATCACTTATATATTTTGGG + Intronic
1053657873 9:40238555-40238577 TTCAATGATCTCTAATTTTTAGG + Intronic
1053908241 9:42867829-42867851 TTCAATGATCTCTAATTTTTAGG + Intergenic
1054358377 9:64087507-64087529 TTCAATAATCTCTAATTTTTAGG + Intergenic
1054369995 9:64384827-64384849 TTCAATGATCTCTAATTTTTAGG + Intronic
1054526723 9:66137670-66137692 TTCAATGATCTCTAATTTTTAGG - Intronic
1054677625 9:67874581-67874603 TTCAATGATCTCTAATTTTTAGG + Intronic
1055456034 9:76472378-76472400 TTCACTCAATTCTACTTTTTTGG - Intronic
1058637807 9:107053608-107053630 CTCAGCCAGTTCTACATTTTAGG + Intergenic
1059091969 9:111369120-111369142 TTCATTCTCCTCTTCATTTTTGG + Exonic
1203703887 Un_KI270742v1:19356-19378 TTCAATGATCTCTAATTTTTAGG + Intergenic
1203560135 Un_KI270744v1:46467-46489 TTCAATGATCTCTAATTTTTAGG - Intergenic
1186361486 X:8846579-8846601 TTGAAACAGCTCTACAATGTTGG - Intergenic
1187404065 X:18986450-18986472 TTCAATAAGCTCAAAATTCTGGG + Intergenic
1189356026 X:40310460-40310482 TTCAATCATGTTTTCATTTTAGG + Intergenic
1189859123 X:45254023-45254045 TTGGATCAGCTATATATTTTTGG + Intergenic
1190413359 X:50158515-50158537 TTGTACCAGCTCTACATTCTAGG + Intergenic
1190649922 X:52558952-52558974 TTCATTCAGCTCTACAGCCTAGG + Intergenic
1190845330 X:54185445-54185467 CTCTATCTGTTCTACATTTTAGG - Intergenic
1193403468 X:81073559-81073581 TTCAATCACCTTTGCATCTTGGG + Intergenic
1193867955 X:86760558-86760580 TTTAATCATGTCTATATTTTTGG + Intronic
1193894165 X:87090904-87090926 TTTAATCAGTTCTAAATTTGGGG - Intergenic
1194204372 X:90994821-90994843 ATCAATCATTTCTTCATTTTAGG + Intergenic
1196023435 X:111014361-111014383 TTTTATCTGCTTTACATTTTGGG - Intronic
1197105412 X:122707986-122708008 TTCCTTCTGCTTTACATTTTTGG - Intergenic
1200130857 X:153844631-153844653 TTCAATCACCTCTGTATTTCTGG - Intergenic
1200275927 X:154732603-154732625 TTCAAGCATTTCTACTTTTTAGG - Intronic
1200359816 X:155592818-155592840 AGCAATCAGCTCTACTTTGTGGG - Intronic
1200550212 Y:4570261-4570283 ATCAATCATTTCTTCATTTTAGG + Intergenic