ID: 1138078359

View in Genome Browser
Species Human (GRCh38)
Location 16:54065014-54065036
Sequence CATTGTGACCAGAGTCAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 183}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138078359_1138078369 17 Left 1138078359 16:54065014-54065036 CCCGCCTGACTCTGGTCACAATG 0: 1
1: 0
2: 1
3: 16
4: 183
Right 1138078369 16:54065054-54065076 AGGCACGTACCACTGAGGCTGGG 0: 1
1: 0
2: 2
3: 8
4: 167
1138078359_1138078370 18 Left 1138078359 16:54065014-54065036 CCCGCCTGACTCTGGTCACAATG 0: 1
1: 0
2: 1
3: 16
4: 183
Right 1138078370 16:54065055-54065077 GGCACGTACCACTGAGGCTGGGG 0: 1
1: 0
2: 2
3: 7
4: 160
1138078359_1138078364 -3 Left 1138078359 16:54065014-54065036 CCCGCCTGACTCTGGTCACAATG 0: 1
1: 0
2: 1
3: 16
4: 183
Right 1138078364 16:54065034-54065056 ATGGCCACTGTCAGGCACCAAGG 0: 1
1: 0
2: 3
3: 14
4: 187
1138078359_1138078366 12 Left 1138078359 16:54065014-54065036 CCCGCCTGACTCTGGTCACAATG 0: 1
1: 0
2: 1
3: 16
4: 183
Right 1138078366 16:54065049-54065071 CACCAAGGCACGTACCACTGAGG 0: 1
1: 0
2: 0
3: 9
4: 89
1138078359_1138078368 16 Left 1138078359 16:54065014-54065036 CCCGCCTGACTCTGGTCACAATG 0: 1
1: 0
2: 1
3: 16
4: 183
Right 1138078368 16:54065053-54065075 AAGGCACGTACCACTGAGGCTGG 0: 1
1: 0
2: 1
3: 26
4: 516

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138078359 Original CRISPR CATTGTGACCAGAGTCAGGC GGG (reversed) Intronic
900518048 1:3092472-3092494 CATTGTGACCATGGACATGCTGG + Intronic
900574531 1:3376526-3376548 CAGTGAGACCACAGTCAGGCGGG + Intronic
902531066 1:17091061-17091083 GAATGTGCCCAGAGTCAGGCTGG - Intronic
902759457 1:18571735-18571757 CACTGTGACCAGAGGTGGGCTGG - Intergenic
904250857 1:29223212-29223234 CATTGTGACCTTATCCAGGCTGG - Intronic
904619488 1:31766696-31766718 CATTATTACCAGAGTGAGTCTGG - Intergenic
904712971 1:32444891-32444913 CAGTCTGAGCAGAGTCAGGAGGG + Intergenic
904750786 1:32740670-32740692 CCGTGTGACCAGAGTCAGATTGG + Intergenic
906796154 1:48697932-48697954 AGTTGTGACCAGAGTCAGGCTGG - Intronic
907062727 1:51447532-51447554 CAATCTGACAAGAGGCAGGCTGG + Intronic
908479824 1:64527551-64527573 AATTTTGACCTGAGGCAGGCTGG + Intronic
908499610 1:64730064-64730086 CCTTGTGTCCAGAGACAAGCAGG - Intergenic
909605936 1:77508384-77508406 CATGGTTACCAGAGTGAAGCTGG - Intronic
909652535 1:77991973-77991995 AAATGTGACCAGAGCCTGGCAGG + Intronic
913113192 1:115674116-115674138 CAGTGTGAGCAGAAACAGGCTGG - Intronic
915447009 1:155979605-155979627 CTTTGGGGCCAGAATCAGGCAGG - Intronic
915900941 1:159846375-159846397 CCTGGTGAGCAGAGTCAGCCAGG - Intronic
919649354 1:200130714-200130736 TATTGTGACCAGCTTCAGGAAGG - Intronic
920198606 1:204245502-204245524 CACTGTGTTCAGAGCCAGGCAGG - Intronic
920340369 1:205271826-205271848 CTTGGTGACCCGGGTCAGGCAGG - Exonic
921088336 1:211817862-211817884 CACTCTGTCCAGAGACAGGCTGG + Intronic
922243335 1:223771303-223771325 CCTTGTGATCAGAGTCTGGCTGG - Intronic
922905396 1:229170092-229170114 CATTCTGAGCAGAGTCAAACAGG - Intergenic
923553438 1:234981877-234981899 CTTTATGACCAGAGCCATGCAGG + Intergenic
1063328171 10:5126395-5126417 CACTGGGACAAGAGTGAGGCTGG + Intronic
1065930989 10:30479013-30479035 CAGTGTGAGGAGAGTCAGGAGGG - Intergenic
1065969603 10:30795968-30795990 CAGTGAGGCCAGAGGCAGGCAGG + Intergenic
1066550710 10:36553263-36553285 CAGTGTGATCAGAGGCAGGGTGG + Intergenic
1068102570 10:52573961-52573983 CATTGTGGCAAGAGCCATGCAGG + Intergenic
1070296544 10:75166180-75166202 CAGTGTACCCAGAGTCAGCCAGG + Intronic
1071562294 10:86653667-86653689 CACTGTGACAAGGGTGAGGCTGG + Intergenic
1074760999 10:116667535-116667557 CATTAGGACCAGAGTGAGGTTGG + Intronic
1076519764 10:131074088-131074110 CGTTGTGACCGGGGTCTGGCTGG - Intergenic
1078642706 11:13111244-13111266 CATTGTTCCCTCAGTCAGGCTGG - Intergenic
1079133090 11:17760943-17760965 TCTTGTTACCAGAGTTAGGCGGG + Intronic
1082655841 11:55856316-55856338 CATAGTGACCACAGTCAGGTGGG - Intergenic
1083296063 11:61716259-61716281 CAGTGTGACCAGGGCCATGCTGG + Intronic
1084661581 11:70549550-70549572 CAGTGTGGCCAGGGGCAGGCGGG + Intronic
1085276237 11:75302054-75302076 TAGTGTGCCCAGAGTCAGACTGG + Intronic
1085655859 11:78314114-78314136 CACTGAGCCCTGAGTCAGGCAGG + Intronic
1085733445 11:79018710-79018732 CATTGTGATTTGAGCCAGGCAGG + Intronic
1086165101 11:83768885-83768907 AATGGACACCAGAGTCAGGCAGG + Intronic
1088605212 11:111523455-111523477 CATTATGACCAGCGGCTGGCAGG + Intronic
1089547665 11:119242252-119242274 CACTGTGCCCAGTTTCAGGCTGG - Intronic
1089652339 11:119922446-119922468 CTTTGTGAGCAGAGTGTGGCTGG + Intergenic
1090157591 11:124458082-124458104 CAGTGGGACCAGAGTCCGGAGGG - Intergenic
1091677177 12:2500007-2500029 CTTTCAGACCAGAGCCAGGCAGG + Intronic
1092265983 12:6980888-6980910 CATAGAGACCTGAGTCATGCAGG - Intronic
1093609816 12:21140095-21140117 TATTGTGACCAGAGGCAGACAGG + Intronic
1093708229 12:22298715-22298737 TATTGTGAAAACAGTCAGGCAGG + Intronic
1094064183 12:26345959-26345981 CATTTTGACCAAAGTCATCCTGG - Intronic
1095369905 12:41454615-41454637 CCTTGTGACCAGTGTCACACCGG - Intronic
1098221607 12:68275646-68275668 CATCGTGACCAGAGGCTTGCAGG - Intronic
1100873788 12:98941083-98941105 TATTGTGACCAGAGGCTTGCAGG - Intronic
1111265793 13:85811408-85811430 TACTGTGACCAGAGGCTGGCAGG + Intergenic
1111412629 13:87896238-87896260 CAGTGGGAGCAGAGTCAGGATGG - Intergenic
1113336435 13:109380899-109380921 TATTGTGACCAGAGTCTTGAAGG + Intergenic
1114715454 14:24819240-24819262 CACAGTGACCAGACTCCGGCAGG + Intronic
1115211346 14:30970228-30970250 CATTCTGAGGAGAGTCAGGAGGG - Intronic
1120864927 14:89287519-89287541 CATTGTGGCCATTGTCAGGTGGG + Intronic
1120929538 14:89834931-89834953 CATTGTGACCAGAATGAAGCGGG + Intronic
1121017757 14:90558708-90558730 CAGTGTGAACAGAGGCCGGCAGG - Intronic
1125004471 15:34801414-34801436 CCTTGGTACCAGAGTCAGACAGG - Intergenic
1131503802 15:92998016-92998038 CACTGAGACCAGATTCAGTCTGG + Intronic
1132632645 16:927290-927312 CACTGAGACCAGAGACACGCAGG + Intronic
1133617457 16:7491411-7491433 CATTGTGAGCAGAAGCAGCCTGG + Intronic
1134012572 16:10866306-10866328 CATTCTCACCTGAGTCAGGATGG - Intergenic
1138078359 16:54065014-54065036 CATTGTGACCAGAGTCAGGCGGG - Intronic
1140230659 16:73114765-73114787 CCTTGTGATCAAAGACAGGCTGG - Intergenic
1140244983 16:73239929-73239951 CATTGTGACCAGAGGCTTGCAGG - Intergenic
1141246660 16:82314170-82314192 CCATGTGAACAGAGTCAGGCTGG + Intergenic
1141275205 16:82581336-82581358 CATTGTGACCACTGTCAGTTAGG + Intergenic
1142851429 17:2706633-2706655 CTCTGTCACTAGAGTCAGGCAGG - Intronic
1143983418 17:10890607-10890629 CATCGTGACCAGAGTGCCGCTGG + Intergenic
1147794058 17:43030218-43030240 CAGTGGGACCAGAGCCAGGAAGG - Intergenic
1151146323 17:72044935-72044957 CATAGTCACCACAGTCAGGGAGG + Intergenic
1151885897 17:76923308-76923330 CATCATAAGCAGAGTCAGGCTGG - Intronic
1152496552 17:80676799-80676821 CATGGAGAACAGAGTCAGGGAGG + Intronic
1152633808 17:81422452-81422474 GTCTGTGCCCAGAGTCAGGCAGG - Intronic
1153776936 18:8462747-8462769 CATTGTGAAAAGAGAAAGGCAGG - Intergenic
1153971817 18:10234060-10234082 CAGTGTGGCCTGAGTCAGGATGG - Intergenic
1157295713 18:46441278-46441300 CACTGTGCCCAGACGCAGGCTGG + Intronic
1160305922 18:77736512-77736534 CCTTGTGCTCAGAGTCAGGAGGG + Intergenic
1161076298 19:2287399-2287421 CATGGTAAGCAGAGTCAGACAGG + Intronic
1161287025 19:3473874-3473896 CATTGTGGCCAGGCTGAGGCTGG + Intergenic
1168282093 19:55311407-55311429 GACAGTGACCTGAGTCAGGCTGG + Intronic
926321251 2:11749611-11749633 CATTGTGAAAAGTGTCAGCCTGG - Intronic
928176340 2:29036776-29036798 CATGGTGACCAGAGCCACACAGG - Intronic
928209371 2:29312269-29312291 AATTGTGTCTAGATTCAGGCTGG + Intronic
928534412 2:32226436-32226458 CATCTTGACCACGGTCAGGCAGG - Intronic
930495579 2:52137759-52137781 AATTCTGACCAGAGTCAACCAGG + Intergenic
931864964 2:66399600-66399622 CACTGTGACCATAGAAAGGCAGG + Intergenic
932422939 2:71612074-71612096 CCTAGTGGCCAGAGTAAGGCAGG + Intronic
935970566 2:108527279-108527301 CAGTCTGAGGAGAGTCAGGCGGG - Intergenic
936117292 2:109712273-109712295 ATGAGTGACCAGAGTCAGGCAGG - Intergenic
936171048 2:110175070-110175092 CATTGTGACCAGAGGCTCACAGG + Intronic
936419614 2:112350611-112350633 CAGTCTGAGGAGAGTCAGGCGGG + Intergenic
937451073 2:122002554-122002576 CATTGAGAGCTGAGTCATGCCGG - Intergenic
939240696 2:139555790-139555812 CATTGATACCAGAGTAAGGGGGG + Intergenic
940672052 2:156682570-156682592 AATTGAGACCAGAGTGATGCAGG + Intergenic
941352794 2:164456798-164456820 CATTGTGCCCAGATGCAGCCTGG + Intergenic
945971154 2:216233584-216233606 CAGTGTGAGCAGGTTCAGGCAGG + Intergenic
1169516646 20:6323255-6323277 TATTGTGACCAGAGTCTGACAGG - Intergenic
1171308969 20:24130752-24130774 GATTGATACCAGAGTCAGGTTGG + Intergenic
1172132051 20:32662240-32662262 CAGTGTGCCCAGAGTCAGCCAGG - Intergenic
1172298489 20:33831122-33831144 CTTTGTCACAAGACTCAGGCTGG + Intronic
1172955623 20:38756111-38756133 GGTTGTGCCCAGAGTCAGGAGGG + Intronic
1174126589 20:48311120-48311142 CATTGTCACCTGCCTCAGGCTGG - Intergenic
1175175947 20:57112219-57112241 GATTGGGACCAGAACCAGGCTGG + Intergenic
1175844230 20:62050279-62050301 CATGGGGAGCAGAGCCAGGCCGG - Intronic
1176287296 21:5024849-5024871 CATGGAGAACAGAGGCAGGCAGG + Intronic
1176422773 21:6529412-6529434 CAGTGTGACCAGTTTCATGCGGG + Intergenic
1177781666 21:25628847-25628869 CATTGAGTCTAGAGTCAGCCAGG + Intergenic
1179057582 21:37950337-37950359 TATTGTGACCAGAGGCTCGCAGG - Intergenic
1179698266 21:43137728-43137750 CAGTGTGACCAGTTTCATGCGGG + Intergenic
1179869885 21:44238626-44238648 CATGGAGAACAGAGGCAGGCAGG - Intronic
1181379463 22:22489200-22489222 CATTTTGAACAGAGTCACCCCGG - Exonic
1182054437 22:27338856-27338878 CAATGGGACCAGAGACAGCCTGG + Intergenic
1185034097 22:48462073-48462095 CACTGTGACCAGAGTCTTCCAGG + Intergenic
1185277841 22:49957459-49957481 CATGGTGACCCAAGCCAGGCTGG - Intergenic
949212235 3:1516802-1516824 AATTGTAACCAGAGTGAGGATGG + Intergenic
949737447 3:7190240-7190262 CATGGTGATCAGAGTAAGGCAGG + Intronic
950029324 3:9841755-9841777 CACTGTGCCCAGCGTCAGGGAGG + Intronic
952386113 3:32842889-32842911 CATTAAGGCCAGAGTAAGGCAGG - Intronic
952762771 3:36929825-36929847 CCCTGTGGCCAGAGTCAGACAGG + Intronic
952990806 3:38829325-38829347 CTTAGGGGCCAGAGTCAGGCAGG - Intergenic
953742549 3:45550026-45550048 CATTTTGAGCAGAGTGTGGCTGG + Intergenic
955776208 3:62436503-62436525 CATTGAAAACAGAGACAGGCAGG - Intronic
960673814 3:120176111-120176133 CATCATGACCAGAGGCAGGGAGG - Intronic
961544533 3:127623189-127623211 GATTGAGGCCAGAGTCAGGCAGG + Intergenic
962321273 3:134392640-134392662 CACTGTGCTCAGAGTGAGGCTGG - Intergenic
962721461 3:138179068-138179090 CATTGTGTCCAGAGTGATGTTGG + Intergenic
963000863 3:140680337-140680359 GAATGAGACCAGAGTGAGGCAGG - Intronic
964344368 3:155741240-155741262 CCTTGTGACCAAAGCCAGCCTGG + Intronic
967323469 3:188216565-188216587 CATTATGAGCAGAGTTAGGTGGG - Intronic
972351629 4:38241786-38241808 CATGTTGATCAGGGTCAGGCTGG - Intergenic
975013916 4:69387313-69387335 CATTGTGTCAACAGTGAGGCAGG - Intronic
979494317 4:121367237-121367259 CATTGTGCCCACAGTCTGGGTGG + Intronic
979852654 4:125592504-125592526 CATTTTGACCAGATTTAGTCAGG - Intergenic
980177537 4:129365078-129365100 GATTGTCACCAGAATCAGCCTGG + Intergenic
980805518 4:137808142-137808164 CATTTGGAACAGAGACAGGCAGG + Intergenic
984749425 4:183257403-183257425 CACTGAGGGCAGAGTCAGGCAGG + Intronic
986840704 5:11693864-11693886 CATTGTGACCAAAGGCTTGCAGG - Intronic
987930556 5:24395004-24395026 CAGTGTGAGGAGAGTCAGGAGGG + Intergenic
992800653 5:80292769-80292791 CACTGACACCAGAGTGAGGCTGG - Intergenic
1001449211 5:171811117-171811139 TATTGTGACCAGAGGCTTGCAGG - Intergenic
1001976850 5:176007178-176007200 CAGGGTGACCAGAGACAGGTGGG - Intronic
1002240578 5:177836602-177836624 CAGGGTGACCAGAGACAGGTGGG + Intergenic
1002318902 5:178363525-178363547 ATTTGGGACCAGAGTCTGGCTGG - Intronic
1003409260 6:5848985-5849007 CATTGTGATCAGTGTCATGAAGG - Intergenic
1006052089 6:31353013-31353035 CATTATAACCAGAGTAAGGAAGG - Intronic
1006325793 6:33352865-33352887 CAGTGTGAGGAGAGTCAGGAGGG + Intergenic
1006418745 6:33920454-33920476 CATTGTGAGCAGACTCTGGTTGG + Intergenic
1006625607 6:35395632-35395654 CTTGGTGACCAGGGCCAGGCAGG + Intronic
1011570368 6:88728322-88728344 CAGTCTGACGAGAGTCAGGAGGG - Intronic
1011760194 6:90555741-90555763 CATGGTGACCAGAGGCACACAGG - Intronic
1015595474 6:134862078-134862100 CATTGTGACCAGAGACTTGCAGG - Intergenic
1016479516 6:144467122-144467144 CACTGTGAGCTGAGTCAGGTGGG + Intronic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1018493846 6:164327246-164327268 CCTTGTGAGCAGAGTCACGATGG + Intergenic
1019420343 7:947904-947926 CAGTGTGCCCAGAGCCAGGGCGG - Intronic
1020018124 7:4843566-4843588 CAAAATGCCCAGAGTCAGGCTGG - Intronic
1020413336 7:7917252-7917274 AATAGTGACCATATTCAGGCTGG + Intronic
1020711385 7:11609664-11609686 TATTGTGACCACAGGCAGGGAGG + Intronic
1021848010 7:24781172-24781194 CAGTGTGACCACAGACAGGCAGG + Intergenic
1022456508 7:30563036-30563058 CATTCTAACCAGAGTCAAGAGGG - Intergenic
1026426080 7:70295285-70295307 TATTCTGATCAGAGTCAGCCTGG + Intronic
1028809167 7:95064181-95064203 AAATGTGACCAGAGGCTGGCAGG - Intronic
1029383177 7:100226557-100226579 CATGGTGACCAGAGCTGGGCAGG - Intronic
1032192388 7:129772407-129772429 AATGGTGTCCAGTGTCAGGCAGG - Intergenic
1033991253 7:147290107-147290129 TATTGTGATCAGAGGCTGGCAGG - Intronic
1034728397 7:153361919-153361941 CAGTGTGACTAGAATAAGGCAGG - Intergenic
1041654762 8:60337487-60337509 AAATGTGACCAGAGGCTGGCAGG - Intergenic
1042914742 8:73864511-73864533 TAATGTGACCAGAGGCTGGCAGG - Intronic
1044288639 8:90441007-90441029 CATGGTGATCAGAGTCAGCTAGG - Intergenic
1044852426 8:96442104-96442126 CGTGATGAGCAGAGTCAGGCTGG + Intergenic
1045378639 8:101600786-101600808 CAGTGTGACCAGGGAGAGGCAGG + Intronic
1052338846 9:27345614-27345636 CAAAGTCAACAGAGTCAGGCAGG - Intronic
1053110758 9:35457696-35457718 CATTCTGAGGAGAGTCAGGAGGG + Intergenic
1055353362 9:75412380-75412402 CAGGGTGGGCAGAGTCAGGCAGG + Intergenic
1055472409 9:76626111-76626133 CATTGTGACCAGATGCTTGCAGG + Intronic
1056543983 9:87597811-87597833 CAGTGTGAGCAGAGGCAGGAAGG - Intronic
1056950927 9:91040100-91040122 CTTTGTGACAAGCCTCAGGCAGG - Intergenic
1061935364 9:133854622-133854644 CGCTGTGACCAGAAGCAGGCTGG + Intronic
1062522330 9:136963491-136963513 CTCTGTGTCCCGAGTCAGGCAGG - Intergenic
1186144155 X:6608518-6608540 CAGTGTAAGCGGAGTCAGGCAGG - Intergenic
1186310723 X:8315454-8315476 TATCGTGACCAGAGGCTGGCGGG + Intergenic
1186363160 X:8863654-8863676 CATTAAAACCGGAGTCAGGCAGG + Intergenic
1187030054 X:15477395-15477417 TATTGTGACCAGAGGCTTGCAGG - Intronic
1188777466 X:34238533-34238555 CATTGTAAACAGCCTCAGGCAGG - Intergenic
1189357289 X:40319976-40319998 TATTGTGACCAGAGGCTTGCAGG + Intergenic
1189502703 X:41578372-41578394 GAATGTGACCAGAGTTCGGCTGG - Exonic
1189559805 X:42180649-42180671 CATTGTGACCAGGGACTTGCAGG + Intergenic
1189739022 X:44099896-44099918 CATTATGACCAGAATGTGGCAGG + Intergenic
1191229892 X:58085575-58085597 CATTCTAACCAGAGTCAGTCCGG + Intergenic
1193251164 X:79291988-79292010 CACTGTCACAAGAGTGAGGCTGG + Intergenic
1193395185 X:80975498-80975520 ATTTGTGACCAGAGTCAGGATGG + Intergenic
1196080302 X:111623462-111623484 GGTTGTTACCAGAGTCAGGATGG - Intergenic
1199298458 X:146185887-146185909 CACTGGGACAAGAGTGAGGCTGG - Intergenic
1199744965 X:150766725-150766747 CATGGTGACCAGAGCCCGCCAGG + Exonic
1201895136 Y:18984928-18984950 CTTTCTGACCAGACACAGGCTGG - Intergenic