ID: 1138081592

View in Genome Browser
Species Human (GRCh38)
Location 16:54095762-54095784
Sequence ATATGGTGGTTGGAGTGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 134}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138081584_1138081592 -5 Left 1138081584 16:54095744-54095766 CCCCCGCCTGGGACTCAGATATG 0: 1
1: 0
2: 2
3: 5
4: 122
Right 1138081592 16:54095762-54095784 ATATGGTGGTTGGAGTGTCCTGG 0: 1
1: 0
2: 3
3: 13
4: 134
1138081588_1138081592 -8 Left 1138081588 16:54095747-54095769 CCGCCTGGGACTCAGATATGGTG 0: 1
1: 0
2: 2
3: 10
4: 150
Right 1138081592 16:54095762-54095784 ATATGGTGGTTGGAGTGTCCTGG 0: 1
1: 0
2: 3
3: 13
4: 134
1138081587_1138081592 -7 Left 1138081587 16:54095746-54095768 CCCGCCTGGGACTCAGATATGGT 0: 1
1: 0
2: 2
3: 15
4: 175
Right 1138081592 16:54095762-54095784 ATATGGTGGTTGGAGTGTCCTGG 0: 1
1: 0
2: 3
3: 13
4: 134
1138081583_1138081592 -4 Left 1138081583 16:54095743-54095765 CCCCCCGCCTGGGACTCAGATAT 0: 1
1: 0
2: 1
3: 8
4: 230
Right 1138081592 16:54095762-54095784 ATATGGTGGTTGGAGTGTCCTGG 0: 1
1: 0
2: 3
3: 13
4: 134
1138081585_1138081592 -6 Left 1138081585 16:54095745-54095767 CCCCGCCTGGGACTCAGATATGG 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1138081592 16:54095762-54095784 ATATGGTGGTTGGAGTGTCCTGG 0: 1
1: 0
2: 3
3: 13
4: 134
1138081579_1138081592 15 Left 1138081579 16:54095724-54095746 CCCTCTGTCTTTTCTGCTGCCCC 0: 1
1: 1
2: 4
3: 62
4: 628
Right 1138081592 16:54095762-54095784 ATATGGTGGTTGGAGTGTCCTGG 0: 1
1: 0
2: 3
3: 13
4: 134
1138081580_1138081592 14 Left 1138081580 16:54095725-54095747 CCTCTGTCTTTTCTGCTGCCCCC 0: 1
1: 0
2: 4
3: 41
4: 552
Right 1138081592 16:54095762-54095784 ATATGGTGGTTGGAGTGTCCTGG 0: 1
1: 0
2: 3
3: 13
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138081592 Original CRISPR ATATGGTGGTTGGAGTGTCC TGG Intronic
901714613 1:11143247-11143269 TTAAGGTGGTGGCAGTGTCCTGG + Intronic
904290165 1:29479880-29479902 AGATGGTGGTTGCAGCTTCCGGG + Intergenic
905918259 1:41700690-41700712 ATATGGTGATGGGAGAGTCCTGG - Intronic
906476319 1:46171773-46171795 ATCTGATCCTTGGAGTGTCCTGG - Intronic
907679219 1:56548069-56548091 CTAAGGTGGTTGGAGTAACCTGG + Intronic
907848672 1:58233420-58233442 ATATGGTGATCGGAGGGCCCTGG - Intronic
908939085 1:69410264-69410286 ATCTGGTGGCTGCAGTGTGCTGG + Intergenic
909806168 1:79876014-79876036 ATTTGGTGGCTGCAGTGTGCTGG - Intergenic
913440461 1:118891551-118891573 ATATGATGCTTTGATTGTCCAGG - Intronic
915579024 1:156802309-156802331 ATTTGGTGGTTGGAATTTCCTGG + Intergenic
915579473 1:156804842-156804864 GTATGGTGGTGGCAGTGCCCAGG + Intergenic
917207154 1:172588521-172588543 ATATGGTGGTTTGAGTCATCTGG + Intronic
921312300 1:213856210-213856232 ATATGGTGGCTGGAATGTGTCGG + Intergenic
922200998 1:223401269-223401291 ATATTCTGGTGGGAGTGACCCGG + Intergenic
923780031 1:237013958-237013980 ATATGGAGGTGGGGGTGTCCTGG - Intergenic
1064065505 10:12177618-12177640 AGAGGGTTGTTGGGGTGTCCTGG + Intronic
1064701211 10:18023657-18023679 TTATGCTGGTTGCAGTGTGCTGG + Intronic
1064995898 10:21296539-21296561 AGATGTTGGGTGGAGTCTCCGGG - Intergenic
1071065518 10:81630030-81630052 ATATTGTGGTTGCAGTTTTCTGG - Intergenic
1071252092 10:83829305-83829327 ATATTGTGGATGGAGAGTCTAGG - Intergenic
1076246303 10:128950142-128950164 CTAAGGAGCTTGGAGTGTCCAGG - Intergenic
1078380229 11:10833448-10833470 ATATGGAGGTTGCAGTGAGCCGG + Intronic
1079837298 11:25350633-25350655 ACATGGTGGTTGCAGTGTGCTGG + Intergenic
1082615687 11:55356777-55356799 ATATGGTGATTGCAGTGTGTTGG - Intergenic
1086303918 11:85459641-85459663 ATATAGTGGCTGTAGTGTGCTGG + Intronic
1088349159 11:108865289-108865311 CTATGCTGCTTGAAGTGTCCAGG + Intronic
1097194666 12:57236795-57236817 ATATGGTTGTAGGAGATTCCAGG - Intronic
1098894983 12:76048864-76048886 ATCTGGTTGTAGGAGTGTTCGGG - Intronic
1099184811 12:79505010-79505032 CTATGGTGGCTGCAGTGTGCTGG - Intergenic
1101633884 12:106521397-106521419 ATATGGAGTTGGGTGTGTCCAGG + Intronic
1102827784 12:115964427-115964449 TTATGATGGATGTAGTGTCCTGG - Intronic
1103666710 12:122573138-122573160 CTATGGTGGTTGTATTTTCCTGG - Exonic
1104468094 12:129006132-129006154 ATATGGTAGTTGGAGCTTCAGGG + Intergenic
1104940531 12:132392515-132392537 GTGGGGTGGTTGGAGGGTCCCGG - Intergenic
1105265548 13:18810906-18810928 ATAGGGTAGATGGCGTGTCCAGG - Intergenic
1106307992 13:28530693-28530715 ATATGGTGGTAGGGGTGTCCAGG + Intergenic
1108322371 13:49301411-49301433 CTATGGGGTTTGGAGTTTCCAGG + Intergenic
1109308307 13:60663828-60663850 GTATGGTGGCTGTAGTGTGCTGG - Intergenic
1110804238 13:79736257-79736279 ATATGGTGGCTGCAGTGTGCTGG + Intergenic
1111604482 13:90519952-90519974 ATATAGTGGCTGTGGTGTCCTGG - Intergenic
1112423298 13:99273489-99273511 ATATGGTAGTTTGCCTGTCCTGG + Intronic
1112852299 13:103721239-103721261 ACATGGTGCTTGGAGTGCACAGG - Intergenic
1116300572 14:43176068-43176090 ATATGGTAGTGGGATTGACCAGG + Intergenic
1120390659 14:83903662-83903684 ATATGGTGGTTGAAGTTACAAGG - Intergenic
1202832951 14_GL000009v2_random:57211-57233 ATAGGGTAGATGGTGTGTCCAGG + Intergenic
1123877907 15:24642593-24642615 ATATGGTGGCTACAGTGTGCTGG - Intergenic
1125206912 15:37163669-37163691 ATAAGGTGGTTGAAGTCTGCAGG - Intergenic
1126233432 15:46354265-46354287 ATATGGTGGCTGTGGTGTGCTGG - Intergenic
1131641055 15:94294409-94294431 AACTGGTGGTTCCAGTGTCCAGG + Intronic
1132146636 15:99433289-99433311 AGATGCTGGCTGGAGGGTCCAGG + Intergenic
1132193822 15:99894412-99894434 ATATGCTGGTTGGAATTACCAGG - Intergenic
1133770851 16:8866719-8866741 GGATGGGGGTTGGAGTGTCCAGG + Intronic
1138081592 16:54095762-54095784 ATATGGTGGTTGGAGTGTCCTGG + Intronic
1138212853 16:55177672-55177694 ATATGGTGGTTGTAGTGTCTAGG + Intergenic
1138583634 16:57957100-57957122 AGATGGTGGTTGGAGGCCCCCGG - Intronic
1141700231 16:85638975-85638997 AAATGGGGCTTGGAGTGCCCGGG + Intronic
1141917143 16:87106840-87106862 ATATGGTGGCTGGAGAGTAGAGG + Intronic
1144887430 17:18472832-18472854 ATATGGTGGCTGGAGTCCACGGG - Intergenic
1145144786 17:20471462-20471484 ATATGGTGGCTGGAGTCCACGGG + Intergenic
1146751982 17:35389946-35389968 ATATGGTGGCTGCAGTGTGCTGG + Intergenic
1148906720 17:50917074-50917096 CTATGGGGCTTGGAGTGCCCTGG - Intergenic
1151142210 17:72004520-72004542 ATTTGCTAGTTAGAGTGTCCTGG - Intergenic
1153424286 18:4945383-4945405 GTATGGTGGCTGCAGTGTGCTGG - Intergenic
1154422853 18:14250620-14250642 ATAGGGTAGATGGCGTGTCCAGG + Intergenic
1155470023 18:26181955-26181977 ATATGGAGGTTTTAGTGGCCTGG + Intronic
1163860644 19:19741005-19741027 GTATCCTGGTCGGAGTGTCCTGG + Intergenic
1164514646 19:28923331-28923353 GTTTGGGGGTTGGGGTGTCCTGG + Intergenic
1202639727 1_KI270706v1_random:70513-70535 ATAGGGTAGATGGTGTGTCCAGG - Intergenic
928684085 2:33729876-33729898 AGATGGTGATGAGAGTGTCCTGG + Intergenic
928895596 2:36259039-36259061 ATATGCTGATTGGGGTGACCAGG - Intergenic
932778896 2:74547530-74547552 TTAAAGTGGTTTGAGTGTCCAGG + Intronic
935482151 2:103603799-103603821 AGATGGTGGTTGAAGTCTTCTGG + Intergenic
935688803 2:105711994-105712016 GTGTGGTGGCTGGAGTGTCGTGG + Intergenic
937819311 2:126289946-126289968 ATAGGGTGGTTGGAGTGGGCTGG - Intergenic
939090003 2:137769094-137769116 ATTTGGTGGTGGCAGTGTTCTGG + Intergenic
940446839 2:153786321-153786343 AAATGGTGGCTGCAGTGTGCTGG - Intergenic
941527929 2:166628989-166629011 GTATGGTGGTTGCTGTGTGCTGG + Intergenic
943351888 2:186805949-186805971 ATATGGTGGCTGCAGTGTGCTGG + Intergenic
943474376 2:188336585-188336607 AGAATGTGGCTGGAGTGTCCTGG + Intronic
945618920 2:212108901-212108923 CTATGGTGGTAGGAGAGTACAGG + Intronic
946370383 2:219278125-219278147 AGAAGGTGGTGTGAGTGTCCTGG - Intronic
1169690652 20:8327243-8327265 ATTTGGTTGTTGAGGTGTCCAGG + Intronic
1171886387 20:30654868-30654890 ATAGGGTAGATGGCGTGTCCAGG - Intergenic
1176648054 21:9368113-9368135 ATAGGGTAGATGGTGTGTCCAGG - Intergenic
1176850615 21:13909337-13909359 ATAGGGTAGATGGTGTGTCCAGG - Intergenic
1178537784 21:33424588-33424610 AGATGGTGGTTGGAGGGGGCAGG + Intronic
1180194786 21:46186751-46186773 ATTTGGTGGTGGCAGTGTTCTGG - Intergenic
1180362216 22:11911357-11911379 ATAGGGTAGATGGTGTGTCCAGG + Intergenic
1183245933 22:36693416-36693438 AGAAGGTGGTTGCAGTGACCAGG - Intronic
1184990857 22:48168927-48168949 AAATGGAGGTTGGAGAGACCTGG + Intergenic
956102018 3:65778510-65778532 ATATGGGGCTTGGAATGTGCTGG - Intronic
956871343 3:73421231-73421253 CTAGGGTGTTAGGAGTGTCCAGG - Intronic
963051510 3:141147549-141147571 ATACGGTGGCTGCTGTGTCCTGG - Exonic
965440874 3:168712415-168712437 ATATGGTGGTTGGTGTTTAATGG + Intergenic
966669131 3:182507126-182507148 ACATGGTGGGAGGAGTGTCATGG + Intergenic
1202738830 3_GL000221v1_random:36874-36896 ATAGGGTAGATGGTGTGTCCAGG + Intergenic
971105030 4:23515329-23515351 ATATGGGGGTGGGAGTGAGCTGG - Intergenic
973189120 4:47367028-47367050 ATATGGTGGTAGCTATGTCCAGG - Intronic
973369970 4:49236865-49236887 ATAGGGTAGATGGTGTGTCCAGG - Intergenic
973391057 4:49558546-49558568 ATAGGGTAGATGGTGTGTCCAGG + Intergenic
974255273 4:59445196-59445218 ATATGGAGATTGGAGTGTATGGG + Intergenic
975434830 4:74339821-74339843 ATTTGGTGGCAGGATTGTCCTGG - Intergenic
977687095 4:99859674-99859696 ACTGGGTGGTTGGAGTGTCGGGG - Intronic
977971458 4:103218374-103218396 ATATGGTGGCTGTGGTGTGCTGG - Intergenic
980205263 4:129711167-129711189 ATATGGGCGATGGAGTATCCTGG + Intergenic
981878707 4:149581095-149581117 ATTTGGTGGTTGGGGAGTTCTGG + Intergenic
1202767083 4_GL000008v2_random:156368-156390 ATAGGGTAGATGGTGTGTCCAGG - Intergenic
985957078 5:3273855-3273877 AAATGGGGGAGGGAGTGTCCTGG - Intergenic
988734274 5:34005362-34005384 ATATGGTGGGTGGAGATTTCGGG + Intronic
989487726 5:42011433-42011455 TTCTGGTGGTTGGAAAGTCCCGG - Intergenic
989741758 5:44781865-44781887 ATATGGAGGTGGGTGTTTCCAGG + Intergenic
991295417 5:65075076-65075098 ATATTGTGGCTGGATTTTCCCGG + Intergenic
994616119 5:102106990-102107012 ATCTCGTGGTTTGAGTGCCCAGG - Intergenic
995099182 5:108278193-108278215 ATTTGGGGGTTGGAGGGTCAGGG - Intronic
996422773 5:123280428-123280450 ATATGGGGATTGGGGTGTCAAGG + Intergenic
999953353 5:156673650-156673672 ATATGGTGCTTGGATTGTCAAGG - Intronic
1002194109 5:177493087-177493109 ATCTGGTAGGTGGAGTGGCCTGG - Intronic
1004040816 6:11973091-11973113 AGATGTTTGTTGGAGTGTCTGGG + Intergenic
1005811740 6:29521060-29521082 CTATGGGGGATGGAGGGTCCCGG + Intergenic
1009229458 6:61044279-61044301 GTATGGTGGCTGCAGTGTGCTGG + Intergenic
1013535815 6:111062122-111062144 AGATGGTGGTTGGAGAGTTGGGG - Intergenic
1015427685 6:133091129-133091151 TTAAGGTTGTTGGAGAGTCCTGG - Intergenic
1015850593 6:137567934-137567956 AGATTGTGGTTGGAATGTCAGGG + Intergenic
1016038220 6:139404788-139404810 ATATGGTGCTTGTAGGCTCCAGG + Intergenic
1018263964 6:162000303-162000325 ATTTGGTGGTGTCAGTGTCCTGG + Intronic
1021092954 7:16504432-16504454 ATCTGGTGGTGGGAGAGGCCAGG + Intronic
1023210859 7:37803791-37803813 ATATGGTGGCTTCAGTGTGCTGG - Intronic
1024012245 7:45278862-45278884 ACCTGTTGGTTGGAGTGTCTTGG + Intergenic
1024165342 7:46724314-46724336 GTATGGTGGCTGCAGTGTGCTGG - Intronic
1028077523 7:86534424-86534446 ATATGGTGGTTGCGGTGTGCTGG + Intergenic
1028723515 7:94060731-94060753 AGATGGAGGTTGCAGTGTGCTGG + Intergenic
1033657574 7:143383398-143383420 ATAAGGTGATTGGAGAGTCAGGG + Intronic
1037388299 8:18365837-18365859 ATATGGTGTTTGCAGTGTGCTGG - Intergenic
1039920973 8:41894593-41894615 ATATGGTGTCGGGAGTGTCAAGG + Intronic
1042537981 8:69878267-69878289 ATATGGAGGTTGCAGTGAGCCGG - Intergenic
1043828586 8:84960357-84960379 ATTTGGTGTTTGCAGTGTTCTGG - Intergenic
1051002429 9:12300673-12300695 ATATTGTGGTTGTATTGTCTAGG - Intergenic
1051664726 9:19457883-19457905 GTATGGGGGTTGGGGGGTCCTGG - Intergenic
1052811398 9:33063784-33063806 AGATGGTGGTGGGGGTGTCAGGG - Intronic
1055264908 9:74483888-74483910 ATTTGGTGGTTTCAGTGTTCTGG - Intergenic
1058533031 9:105925633-105925655 ATGTGGTGGTTGGAGTGTGCTGG + Intergenic
1059186196 9:112273756-112273778 ATTTGGAGGATGGAGTGTCAGGG - Intronic
1062035417 9:134380547-134380569 GTGTGATGGTTGGGGTGTCCAGG + Intronic
1203707561 Un_KI270742v1:67318-67340 ATAGGGTAGATGGTGTGTCCAGG + Intergenic
1203547834 Un_KI270743v1:141245-141267 ATAGGGTAGATGGTGTGTCCAGG - Intergenic
1192865896 X:75131967-75131989 GTATGGTGGCTGCAGTGTCACGG - Intronic
1194899907 X:99497562-99497584 GTATGGTGGCTGCAGTGTGCTGG - Intergenic
1195208214 X:102625220-102625242 ATATGGTGGCTGCAGTGTGCTGG + Intergenic
1195241796 X:102959904-102959926 ATATGGTGGCTGTGGTGTGCTGG + Intergenic
1196765722 X:119240739-119240761 ATTTGGTGCTTGGTGTGTCAGGG + Intronic
1197727941 X:129788591-129788613 ATATAGGGGATGGGGTGTCCAGG + Intronic