ID: 1138082887

View in Genome Browser
Species Human (GRCh38)
Location 16:54108499-54108521
Sequence TCCTTCTAGGGGAAGCTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 186}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138082887_1138082895 18 Left 1138082887 16:54108499-54108521 CCCCAGAGCTTCCCCTAGAAGGA 0: 1
1: 0
2: 2
3: 15
4: 186
Right 1138082895 16:54108540-54108562 CACCCAGTTAGTATGAAGGAAGG 0: 1
1: 0
2: 3
3: 10
4: 104
1138082887_1138082893 -10 Left 1138082887 16:54108499-54108521 CCCCAGAGCTTCCCCTAGAAGGA 0: 1
1: 0
2: 2
3: 15
4: 186
Right 1138082893 16:54108512-54108534 CCTAGAAGGAGTCTGTCTAGAGG 0: 1
1: 0
2: 2
3: 10
4: 94
1138082887_1138082894 14 Left 1138082887 16:54108499-54108521 CCCCAGAGCTTCCCCTAGAAGGA 0: 1
1: 0
2: 2
3: 15
4: 186
Right 1138082894 16:54108536-54108558 TACGCACCCAGTTAGTATGAAGG 0: 1
1: 0
2: 0
3: 8
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138082887 Original CRISPR TCCTTCTAGGGGAAGCTCTG GGG (reversed) Intronic
900366145 1:2312740-2312762 TCCTTCCAGCGGAGGCTCCGTGG - Intergenic
900791943 1:4686598-4686620 TCCTGCTCGGCAAAGCTCTGCGG - Intronic
901001567 1:6151447-6151469 TCCTTCAAGGGGCAGCCCTAGGG + Intronic
902267365 1:15277279-15277301 GCCTTAAAGGGGAAGCTCTTTGG + Intronic
902711321 1:18241956-18241978 TCCCCCTTTGGGAAGCTCTGTGG + Intronic
905398597 1:37685076-37685098 TCGTTCTAGGGTAAGATTTGGGG - Intronic
905669522 1:39782270-39782292 TCCTTGTAGTGGATGCTGTGGGG - Intronic
908535116 1:65069081-65069103 TCCCACTAGGGTAAGCTTTGAGG + Intergenic
915639764 1:157215743-157215765 TCCTTCTAGGGGCTCCTCTCAGG + Intergenic
916481778 1:165220782-165220804 TCTTTCTACGGGAAGGTGTGTGG + Intronic
918703582 1:187635504-187635526 TCCATCAAGGGTCAGCTCTGGGG - Intergenic
919145603 1:193630511-193630533 GCCTTCAAGGGGGAGCTCTCAGG + Intergenic
919785213 1:201254301-201254323 CTCTGCTGGGGGAAGCTCTGGGG + Intergenic
1063454688 10:6174736-6174758 CTCTGCTGGGGGAAGCTCTGGGG + Intronic
1063486450 10:6424994-6425016 CCCTTCTAGGGGACGCAGTGCGG - Intergenic
1064679393 10:17794748-17794770 TCCTTCTAGGCCAGGCACTGTGG + Intronic
1065886473 10:30081811-30081833 TCCCTTTAGGGGCAGCTCTCAGG - Intronic
1066408890 10:35146275-35146297 TCCTGCTAGGGCATGCTTTGTGG + Intronic
1067348793 10:45457061-45457083 TTCTGCTCGGGGAAGTTCTGTGG - Exonic
1067865889 10:49905606-49905628 TCCTTCTGGGAATAGCTCTGAGG - Intronic
1068236831 10:54246607-54246629 TTCTTCTAGGGTATGCTGTGAGG + Intronic
1071760014 10:88592659-88592681 TCCTTCTAGGGGTAGCCTTCAGG - Intronic
1072395729 10:95038599-95038621 ACCTTCTAGGAGGAGCTCTTGGG + Intronic
1074761344 10:116669617-116669639 TCATTCTTAGGGAAGCTGTGGGG - Intronic
1074881844 10:117665698-117665720 TCCTTCAAGGGGTTGCCCTGAGG - Intergenic
1074987177 10:118668819-118668841 TACTTCTTGGGGTAGCTGTGGGG + Intergenic
1075673992 10:124283188-124283210 CCCTTCTAGATGAAGATCTGGGG + Intergenic
1075919171 10:126196158-126196180 TCATTCTAGGGGATGCTATTTGG + Intronic
1077852238 11:6084740-6084762 TTCTGCTTGAGGAAGCTCTGAGG - Intergenic
1078488217 11:11743399-11743421 TCCTCCTGGGGGCAGCTATGAGG + Intergenic
1078561615 11:12377729-12377751 TCCTTCTTGGGGAAACTCGGAGG + Exonic
1080005076 11:27398088-27398110 TCCTTCCAGGGAAAGCTTTTTGG + Intronic
1082081153 11:48013509-48013531 TCCTGCCTAGGGAAGCTCTGTGG + Intronic
1084416779 11:69037126-69037148 TCTTTCTAAGGGGAGCTCTGTGG - Intergenic
1087935171 11:104025598-104025620 TACCCCTAGGGGAAACTCTGGGG - Intronic
1090334203 11:125951804-125951826 TCCTTCCAGGGGAGCCTCTCGGG + Intergenic
1091849843 12:3686758-3686780 TCCTTCTTGAGGAATCTCTCTGG - Intronic
1098812172 12:75108667-75108689 TCCATTTAAGAGAAGCTCTGAGG - Intronic
1101201409 12:102440174-102440196 TCCTCCCAGGGGAAGCCATGCGG - Intronic
1103338859 12:120210592-120210614 TCCCTCTTGGGGAAGATCTAGGG + Exonic
1106421095 13:29587043-29587065 TCCTTCAAGGAGAGGGTCTGGGG + Intronic
1111386642 13:87537071-87537093 CCCTTGTAGGGGTGGCTCTGAGG - Intergenic
1112364348 13:98743856-98743878 TCCTTCTAGAGTCTGCTCTGAGG - Intronic
1113362639 13:109645346-109645368 AGCCTCCAGGGGAAGCTCTGGGG - Intergenic
1115983413 14:39078397-39078419 TCCTCCTTTGGGAAGATCTGGGG - Intronic
1116801529 14:49449432-49449454 CCCTTATAGGGGAGGCTCTCGGG - Intergenic
1118756933 14:68851762-68851784 TCCTTCTAGGTGAAGTGATGGGG + Intergenic
1120316085 14:82895171-82895193 TCTTTCTAATGTAAGCTCTGTGG - Intergenic
1121305788 14:92906215-92906237 TTCTTCTTGGGGAAGCTGGGAGG + Intergenic
1121466103 14:94116385-94116407 TGCCTGTCGGGGAAGCTCTGTGG - Intronic
1121495135 14:94386896-94386918 ACCTTATAGGGTAAGCTTTGAGG - Intronic
1121509240 14:94500140-94500162 TCCTTCTACGCCAAGCACTGTGG + Intronic
1122723901 14:103737920-103737942 TCCTTAGAGGGAAATCTCTGAGG - Intronic
1123028157 14:105438344-105438366 CCCTTCTTGGGGAAGCTGTGGGG - Intronic
1125594651 15:40876797-40876819 TCCTTCTAGGGCAAGGGCAGTGG - Intergenic
1126417461 15:48432783-48432805 TCCTACTAAGGGAAGCTTTGAGG + Intronic
1127693728 15:61423191-61423213 ACCTTCTAAGGGAAATTCTGGGG - Intergenic
1127839981 15:62822682-62822704 TCCTTCGAGGAGTAGCTCTAAGG - Intronic
1129207558 15:74045984-74046006 TCCTCCAAGGGGAAGCAGTGTGG + Exonic
1130077290 15:80700149-80700171 TCCTTCCAGGGGATCCTCTTAGG + Intronic
1130111387 15:80968288-80968310 TCCTTCTGGAGCAATCTCTGTGG + Intronic
1131984285 15:98025726-98025748 TTCTCCTAGGGGAATCTATGAGG - Intergenic
1132282454 15:100632065-100632087 CACTGCTAGGGGCAGCTCTGAGG - Intronic
1132495498 16:261375-261397 TGATTCTAGGGGAAACCCTGTGG + Exonic
1132696808 16:1205691-1205713 TCCTCCTAGGGGAAGACCGGGGG - Intronic
1136392309 16:29973566-29973588 TGTTGCTAGGGGAAGCTTTGAGG - Intergenic
1137085591 16:36117969-36117991 TAATTCTATGGGAAGCTATGTGG - Intergenic
1138027642 16:53535033-53535055 TACTTCTAGGGAAAGTCCTGTGG + Intergenic
1138082887 16:54108499-54108521 TCCTTCTAGGGGAAGCTCTGGGG - Intronic
1140311243 16:73850598-73850620 CCATCCCAGGGGAAGCTCTGGGG + Intergenic
1143180029 17:4978883-4978905 TCCTTCTGGTGACAGCTCTGTGG - Intronic
1145324556 17:21792080-21792102 TAATTCTATGGGAAGCTATGTGG - Intergenic
1145326048 17:21826729-21826751 TAATTCTATGGGAAGCTATGTGG + Intergenic
1145710877 17:26975004-26975026 TAATTCTATGGGAAGCTATGTGG + Intergenic
1147466314 17:40613858-40613880 TGCTTCTCTGTGAAGCTCTGTGG + Intergenic
1148051361 17:44771602-44771624 TACTACCAGGGGAAGCTCCGGGG + Exonic
1151058898 17:71067916-71067938 TCCTCTTAAGGGAAGCTCAGTGG - Intergenic
1151657348 17:75502232-75502254 CCCATCTCGGGGCAGCTCTGGGG - Exonic
1152080866 17:78186653-78186675 TCCTTCTAGGGGAAGGGAAGGGG + Intronic
1152227779 17:79100655-79100677 CCCGTCTAGGGGCAGCGCTGAGG + Intronic
1203190244 17_KI270729v1_random:177362-177384 TAATTCTATGGGAAGCTATGTGG + Intergenic
1157685682 18:49640728-49640750 TGCTTCCAGGGGCAGCTCTTTGG - Intergenic
1158918270 18:62159358-62159380 TCTTACTAACGGAAGCTCTGTGG - Intronic
1160318321 18:77868190-77868212 CACTTTTAGAGGAAGCTCTGTGG + Intergenic
1161047877 19:2146001-2146023 TGCTGCTGGGAGAAGCTCTGTGG + Intronic
1162124936 19:8494355-8494377 CCGCTCTAGGGGAGGCTCTGTGG - Intronic
1165783016 19:38444685-38444707 TCCATTTAGGGGGAGGTCTGGGG - Intronic
1167435533 19:49476414-49476436 CCCCTCTAGGAGGAGCTCTGCGG + Exonic
1167580154 19:50336658-50336680 TGATTTTCGGGGAAGCTCTGTGG - Intronic
925231159 2:2235207-2235229 GCCTCTAAGGGGAAGCTCTGAGG - Intronic
925231168 2:2235276-2235298 CCCTCTAAGGGGAAGCTCTGAGG - Intronic
925231178 2:2235345-2235367 CCCTCTAAGGGGAAGCTCTGAGG - Intronic
925776870 2:7344324-7344346 TACCTCTAGGGGAAGCTCATAGG - Intergenic
926086263 2:10022255-10022277 GCCTTCCAGGTGAAGCCCTGGGG + Intergenic
926218979 2:10922709-10922731 TCCTCCTGGGGGATGGTCTGAGG + Intergenic
927149433 2:20187270-20187292 TCCTTCTAGGGCAAGCCCTCTGG - Intergenic
927486084 2:23489281-23489303 TCCTTCTACAGAAAGCCCTGGGG + Intronic
932819698 2:74889147-74889169 TCCTTACAGGGGAGGCTCTGTGG - Intronic
933256342 2:80085306-80085328 ACTTTCTGGAGGAAGCTCTGGGG - Intronic
934252820 2:90376111-90376133 TAATTCTATGGGAAGCTATGTGG - Intergenic
934256620 2:91426836-91426858 TAATTCTATGGGAAGCTATGTGG + Intergenic
935022195 2:99242350-99242372 AGCTTCTAGGCAAAGCTCTGTGG - Exonic
936246096 2:110828768-110828790 TGCTTCTTTGGGGAGCTCTGAGG + Intronic
937895373 2:126973647-126973669 TCCCTCTAGGGGAGGCTGTGTGG + Intergenic
938517277 2:132025422-132025444 TAATTCTATGGGAAGCTATGTGG - Intergenic
939088523 2:137750741-137750763 TCCTGCTACTGGTAGCTCTGGGG + Intergenic
940442496 2:153734660-153734682 TCCTTTTAGGAGAAGCAATGTGG + Intergenic
942141088 2:172978203-172978225 CATTTCCAGGGGAAGCTCTGGGG - Intronic
942150150 2:173068130-173068152 TGTGTCTAGGGGAAGCTCTGAGG + Intergenic
942517401 2:176768364-176768386 TCCATCTAGGGGAGGCTCCTTGG - Intergenic
947856549 2:233328251-233328273 TCCCTGTGGGGGAAGCTGTGGGG - Intronic
947903412 2:233741868-233741890 TTCTTCTAGGGTCACCTCTGAGG - Intronic
1168782594 20:506352-506374 GCCCTCCAGGGCAAGCTCTGGGG + Intronic
1172034827 20:32003244-32003266 CCCTCCTGGGGGAAGCTCGGAGG - Exonic
1173413887 20:42838853-42838875 CCTTCCTAGGGGAACCTCTGGGG + Intronic
1173928750 20:46800604-46800626 TCCTTCTTGGGGAGTCTGTGTGG + Intergenic
1174039293 20:47687563-47687585 CCCTTTGAAGGGAAGCTCTGAGG + Intronic
1174780115 20:53382035-53382057 TCCTTGCAGGTGGAGCTCTGAGG + Intronic
1175329738 20:58155336-58155358 GCCTTCTAGGGGAAGCAATGGGG + Intronic
1176736142 21:10548495-10548517 GCCTGCCAGGGGAAGCCCTGGGG - Intronic
1177513751 21:22121953-22121975 CTCTTCTGGGGGAACCTCTGGGG - Intergenic
1181763209 22:25072225-25072247 GCCTCCTAGGGGCAGCTTTGTGG + Intronic
1182065891 22:27431399-27431421 TCCCTCCAGGGAAAGCTCTGTGG - Intergenic
1182567817 22:31212802-31212824 CTCTTATAGTGGAAGCTCTGTGG + Intronic
1183819217 22:40331463-40331485 TCCTCTTTGGGGGAGCTCTGAGG - Exonic
1203326157 22_KI270738v1_random:21590-21612 TAATTCTATGGGAAGCTATGTGG - Intergenic
950109060 3:10407017-10407039 TCCTTCCAGGGTCAGGTCTGGGG - Intronic
952978239 3:38714382-38714404 TCCTTCTAGGGGCAGCAGTCAGG + Intronic
953983550 3:47425001-47425023 TCATTTTAGAGGAAGCTCTTTGG - Intronic
954066731 3:48112632-48112654 CCCTTCTGGGGGAGGCTTTGTGG - Intergenic
954107680 3:48418142-48418164 TCCCTCTAAGGGCAGCACTGAGG + Intronic
954625594 3:52020424-52020446 TCCTTCCAGCTCAAGCTCTGGGG - Intergenic
955920844 3:63954097-63954119 TGCTTCTAGGAGAAGCCCTAGGG + Intronic
956389244 3:68753848-68753870 TCCTTTATGGGGAGGCTCTGGGG - Intronic
961574184 3:127821766-127821788 TCCTGGTAGGGAATGCTCTGCGG + Exonic
966615573 3:181909464-181909486 GCTTTCTAGGGGAATTTCTGGGG - Intergenic
967676694 3:192307617-192307639 TACTGTTAGGGGAAGCACTGAGG + Intronic
972960589 4:44448141-44448163 TCCTTCTCGGGGAAGTGCTCCGG + Exonic
973283036 4:48380931-48380953 TCTTCCTAGGGGAAGCTATATGG - Intronic
973920676 4:55681781-55681803 TCCCTCTGGGGGAAGCGATGTGG + Intergenic
974703753 4:65485522-65485544 TGCTTTTAGGGGAAGCTATCTGG - Intronic
975428580 4:74259802-74259824 TCCTTGTAGGGCAATCTTTGAGG - Intronic
978334301 4:107649148-107649170 CCCTTCTAGGGGAAGCCCTGAGG - Intronic
981030758 4:140123070-140123092 TTCTTCTAGGTAAAGCTCTGCGG + Intronic
981266219 4:142786733-142786755 TGCTTTTAGGGGCAGCTCGGAGG - Intronic
982130438 4:152224333-152224355 TCCTGCCAGGGGTAGCTGTGCGG + Intergenic
983718676 4:170817563-170817585 TCCTTGTAGTGGTAGCACTGAGG - Intergenic
985789092 5:1915808-1915830 TCCCTCCCGGGGCAGCTCTGAGG - Intergenic
986340679 5:6786595-6786617 TCCTTCCGGGTGATGCTCTGGGG - Intergenic
987242924 5:16019349-16019371 TCCATCTAGCAGCAGCTCTGTGG - Intergenic
987257549 5:16171873-16171895 TTCTTCTACAGGAAGCTGTGTGG + Intronic
991504216 5:67307313-67307335 TTCTTCTAGCAGAAGCTCTTTGG + Intergenic
993594831 5:89840967-89840989 TCTGTCTAGGGACAGCTCTGAGG + Intergenic
994340552 5:98622472-98622494 TCCATCTAAGGGATGCTCTCAGG - Intergenic
994761447 5:103859370-103859392 TCCTTCAAAGAGAAGTTCTGTGG - Intergenic
994918102 5:106005142-106005164 CCCTCCTAAGGGAAGCTGTGAGG - Intergenic
996077326 5:119211979-119212001 AGCTTCTAAGGGCAGCTCTGTGG + Intronic
997831055 5:137150442-137150464 TTGTTTTAGGAGAAGCTCTGTGG + Intronic
1000336566 5:160245785-160245807 CCCTCCTGGGGGAAGCTCTGGGG + Intergenic
1001848916 5:174946101-174946123 TGCTTCTAGAGGCAGCCCTGTGG + Intergenic
1005981695 6:30841645-30841667 TCCTAAAAGGGGCAGCTCTGAGG - Intergenic
1006048209 6:31317750-31317772 TCCTAATGGGGGAAGCTTTGGGG - Intronic
1007653163 6:43435680-43435702 TGTTTCTATGGGAAGCCCTGTGG - Intronic
1016884053 6:148941864-148941886 TCCTGCTATGGGAAACTCAGAGG + Intronic
1018763144 6:166907983-166908005 GCCTTCTATGGGAAGCCTTGGGG + Intronic
1020672436 7:11133619-11133641 TCTTGCTAGGGGAAGCACTCTGG - Intronic
1022467003 7:30658671-30658693 ATCTTCTAAGGCAAGCTCTGTGG - Intronic
1022480899 7:30742339-30742361 TGCTTTTAGGGGGAGCTGTGGGG + Intronic
1024401574 7:48929501-48929523 TCATTCTAGGGGTATCTGTGAGG + Intergenic
1025306367 7:57862324-57862346 TAATTCTATGGGAAGCTATGTGG - Intergenic
1025318986 7:58071180-58071202 TAATTCTATGGGAAGCTATGTGG + Intergenic
1025477409 7:60941791-60941813 TAATTCTATGGGAAGCTATGTGG + Intergenic
1025554725 7:62291873-62291895 TAATTCTATGGGAAGCTATGTGG - Intergenic
1025877394 7:65495663-65495685 TAATTCTATGGGAAGCTATGTGG - Intergenic
1029228561 7:99047211-99047233 TCCTTCTCAGGGCAGCTCAGGGG - Intronic
1034356107 7:150451653-150451675 TCCTCCTGGGGGCTGCTCTGCGG - Intronic
1034411681 7:150945452-150945474 GCCTTCTTGGGGAAGCTCTGGGG + Exonic
1035434279 7:158847757-158847779 TCCTTTTGTGGGTAGCTCTGAGG - Intergenic
1036377496 8:8213443-8213465 TCCTTCTATGGCAACCTGTGGGG + Intergenic
1036852063 8:12209705-12209727 TCCTTCTATGGCAACCTGTGGGG - Intergenic
1036873429 8:12452227-12452249 TCCTTCTATGGCAACCTGTGGGG - Intergenic
1038488109 8:27950580-27950602 TCCTTCTGGGTCATGCTCTGGGG - Intronic
1038488326 8:27951855-27951877 TCCTTCTGGGTCATGCTCTGAGG - Intronic
1040289417 8:46116705-46116727 CCCTGCTCGGGGCAGCTCTGGGG + Intergenic
1041118447 8:54563318-54563340 TCCTTCTGAGAGAGGCTCTGAGG - Intergenic
1044599076 8:93985699-93985721 TCCTCCTAGAGGAAGCTTTGGGG + Intergenic
1045210588 8:100094716-100094738 TCCTTTTGGGGGAAGCTATAAGG + Intronic
1046677738 8:117130244-117130266 TCTTTCATGGGAAAGCTCTGAGG + Intronic
1048054263 8:130848482-130848504 TCCTTCTAGTGAAGGCTCTGTGG - Intronic
1051364818 9:16314464-16314486 TCCTTCTAGGGAAAGGGATGAGG - Intergenic
1056943954 9:90977936-90977958 ACCTTCTAGGGGAACCTCCTAGG - Intergenic
1057915680 9:99053460-99053482 TCCTTCCAGGGGAGGCTCACAGG - Intronic
1057947968 9:99346259-99346281 TCTTTGTAGGGGAAGCTTGGTGG - Intergenic
1058845051 9:108949265-108949287 CACTACGAGGGGAAGCTCTGTGG - Intronic
1058967334 9:110049602-110049624 CCCTTCTTGGGGACACTCTGGGG + Intronic
1059607897 9:115855977-115855999 TTCTCCCTGGGGAAGCTCTGGGG - Intergenic
1060590540 9:124813610-124813632 TCCTTCTTGGGGCTTCTCTGTGG - Exonic
1062475067 9:136722659-136722681 TCATCCTCAGGGAAGCTCTGAGG + Intronic
1062716083 9:138010916-138010938 TCACTCTTGGAGAAGCTCTGTGG - Intronic
1188539702 X:31235991-31236013 TCCAGCCAGGGGAAGCTGTGTGG + Intronic
1196689009 X:118539065-118539087 TTCTATTAGGGGAAGCTTTGTGG + Intronic
1197717362 X:129719182-129719204 AGGTTCTAGGGGAACCTCTGGGG - Intergenic
1199035796 X:143050167-143050189 TCCTTCTAGGGGTACCTCTCAGG + Intergenic
1199983363 X:152933346-152933368 TACTTCTTGGTTAAGCTCTGAGG + Intronic