ID: 1138083378

View in Genome Browser
Species Human (GRCh38)
Location 16:54112981-54113003
Sequence GAGGCACGTTAACATGCCAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 59}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138083378_1138083385 27 Left 1138083378 16:54112981-54113003 CCTTTGGCATGTTAACGTGCCTC 0: 1
1: 0
2: 1
3: 6
4: 59
Right 1138083385 16:54113031-54113053 TATGAAAGGCACCAGTCCTAAGG 0: 1
1: 0
2: 0
3: 9
4: 80
1138083378_1138083380 -1 Left 1138083378 16:54112981-54113003 CCTTTGGCATGTTAACGTGCCTC 0: 1
1: 0
2: 1
3: 6
4: 59
Right 1138083380 16:54113003-54113025 CAGTTTCCTCATCTGTATAATGG 0: 20
1: 923
2: 4070
3: 9723
4: 16806
1138083378_1138083382 1 Left 1138083378 16:54112981-54113003 CCTTTGGCATGTTAACGTGCCTC 0: 1
1: 0
2: 1
3: 6
4: 59
Right 1138083382 16:54113005-54113027 GTTTCCTCATCTGTATAATGGGG 0: 16
1: 573
2: 2750
3: 6573
4: 11769
1138083378_1138083381 0 Left 1138083378 16:54112981-54113003 CCTTTGGCATGTTAACGTGCCTC 0: 1
1: 0
2: 1
3: 6
4: 59
Right 1138083381 16:54113004-54113026 AGTTTCCTCATCTGTATAATGGG 0: 17
1: 735
2: 3493
3: 8722
4: 15080
1138083378_1138083384 13 Left 1138083378 16:54112981-54113003 CCTTTGGCATGTTAACGTGCCTC 0: 1
1: 0
2: 1
3: 6
4: 59
Right 1138083384 16:54113017-54113039 GTATAATGGGGATATATGAAAGG 0: 1
1: 0
2: 0
3: 14
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138083378 Original CRISPR GAGGCACGTTAACATGCCAA AGG (reversed) Exonic
901872889 1:12148493-12148515 GAGGCAGGGTAACCTGCCCAAGG + Intergenic
908073014 1:60484392-60484414 GAGGCACTTTAAGATTCCACAGG - Intergenic
908456487 1:64309508-64309530 GAAGCTCATTAACATGCCCACGG + Intergenic
909401858 1:75242074-75242096 GAAGAACGTTAACATTTCAAAGG + Intronic
910166042 1:84328623-84328645 GAGGCAGGTTAACATGGTAGAGG - Intronic
922901632 1:229141607-229141629 GAGTAAAGTTTACATGCCAAGGG + Intergenic
1063540150 10:6925081-6925103 GAGGCAGGATAAAATACCAATGG - Intergenic
1069915087 10:71782435-71782457 AAGGCTCCTTAACATGCCCAAGG + Intronic
1070957496 10:80474027-80474049 GAGGAACATTCACAGGCCAAAGG - Intronic
1072779513 10:98237396-98237418 GAAGCATGATAACATGGCAAAGG - Intronic
1073541148 10:104316894-104316916 GAGGTGTGTTAACATGCCCAGGG - Intronic
1073696310 10:105873005-105873027 TAGGCCCGTTAACATTACAATGG - Intergenic
1078357130 11:10640835-10640857 GAGGCAAGGTAACTTGCCCAAGG - Intronic
1083461285 11:62813986-62814008 AAGGTATGTTAGCATGCCAATGG - Intronic
1090413946 11:126528054-126528076 GAGGCACAGTAACCTGCCCAAGG + Intronic
1104062477 12:125280457-125280479 GAAGCATGTCAAAATGCCAATGG + Intronic
1104581367 12:130013472-130013494 GAGGCTCGTTCACATTACAAGGG + Intergenic
1108303768 13:49109068-49109090 GAAGCAGAGTAACATGCCAAGGG - Intronic
1119432118 14:74575269-74575291 GATGCACGTTAACACTACAAAGG + Intronic
1121501852 14:94444284-94444306 GAGGCAGGTTAGCTTGCCAAGGG - Intronic
1121856932 14:97278770-97278792 GAGGCACATTAGCATGTTAAAGG - Intergenic
1121999054 14:98630949-98630971 GAGGCATATTAAAATGCCTATGG + Intergenic
1131763695 15:95652277-95652299 GAGTCAGGTTAACTTGTCAATGG - Intergenic
1138083378 16:54112981-54113003 GAGGCACGTTAACATGCCAAAGG - Exonic
1146916913 17:36683770-36683792 GAGGCACAGCAACATGCCAAAGG - Intergenic
1159393545 18:67827270-67827292 GAAGCACATTAACATGCCTTAGG + Intergenic
1165223110 19:34333791-34333813 GAGGCACGTTACCATGTGGATGG - Exonic
1167054427 19:47100421-47100443 TAGGCACGTTACCATGGAAATGG - Intronic
926765367 2:16319028-16319050 GAGGCAGGGTGACATGCCCATGG + Intergenic
929126718 2:38529271-38529293 GTACCACGTAAACATGCCAATGG + Intergenic
930668528 2:54123644-54123666 GAGGCACTTTAACATGCCAGGGG - Intronic
938847511 2:135225207-135225229 GAGGCACGTTAACTTACTTATGG + Intronic
940112106 2:150166419-150166441 CAGGAAAGTAAACATGCCAAGGG + Intergenic
942782393 2:179660152-179660174 GAGGTACATTAACCTGCCACCGG + Intronic
1172204386 20:33152505-33152527 AAGGCAAGTTTGCATGCCAAGGG + Intergenic
1173002522 20:39114720-39114742 GAGGCTCTTTAATATGCAAATGG - Intergenic
955136840 3:56227443-56227465 GAGGGACCTTCACATGCTAAAGG - Intronic
964430243 3:156598137-156598159 GAGGCACTGTAACTTGCCCAAGG + Intergenic
964471174 3:157057375-157057397 CAAGCACGTTAACATGTCTATGG - Intergenic
965946649 3:174250503-174250525 GAGGAACTTTAAGATGGCAAAGG + Intronic
968229385 3:196996367-196996389 GAAGCATTTTAACATCCCAAAGG - Intronic
971151416 4:24036069-24036091 GAGGCACAGTAACTTGCCCAAGG - Intergenic
978278951 4:106986236-106986258 GAGGCATGTTAAGAAGCAAAGGG + Intronic
978318931 4:107471922-107471944 GAGGCATGTGAACATACCTATGG + Intergenic
983458117 4:167990304-167990326 GGTGCACTTTAAAATGCCAAAGG - Intergenic
984174365 4:176397776-176397798 GAGGAATGTTAACATGCTAATGG - Intergenic
987690346 5:21258280-21258302 GAGCCATGTTAACATATCAAAGG - Intergenic
995909385 5:117167614-117167636 AAGACACGTTAACAGGCGAAAGG + Intergenic
999007005 5:147992760-147992782 GAGGCAAATGAACCTGCCAATGG + Intergenic
999084512 5:148875110-148875132 GAGGTGAGTTAACATGCCTAAGG - Intergenic
1000170910 5:158702317-158702339 TGGGCAAGTTAGCATGCCAATGG - Intronic
1003135092 6:3428920-3428942 GATGCACATTAACATGCTAAAGG - Intronic
1027599710 7:80224605-80224627 GATGCACATTAGCATGTCAATGG + Intergenic
1028297414 7:89151770-89151792 TAGGCTCTTTAACATGGCAATGG + Intronic
1029730585 7:102435386-102435408 GAGGCACTTTGGCATGCAAAGGG + Intronic
1031034473 7:116773413-116773435 GAGTCACGTTTTCATGCCAAAGG + Intronic
1041521137 8:58757571-58757593 AAGGCATGCTAACAAGCCAAAGG + Intergenic
1042690674 8:71494694-71494716 GAGCAAGGTTTACATGCCAAGGG + Intronic
1045385441 8:101667495-101667517 CAGTCACCTTAACATCCCAAAGG - Exonic
1053030934 9:34777394-34777416 GAGGAATGTTCAGATGCCAATGG + Intergenic
1054725016 9:68641465-68641487 GAGGTAAGTTAACTTGCCAAAGG - Intergenic
1058687735 9:107492242-107492264 GACCCACGTTTACATCCCAAGGG - Intergenic
1060256955 9:122039698-122039720 GAGGTAATTTAACATGCCCAAGG + Intronic
1062629681 9:137458254-137458276 GAGGCCTGTTGCCATGCCAACGG + Intronic
1187586050 X:20662993-20663015 GAGGCAAATTAACCTGCCCAAGG - Intergenic
1195711979 X:107780210-107780232 GATGCACGCTAGCATGCCCAGGG - Intronic
1199954626 X:152733852-152733874 GAGGCAAGGTAAGATGCCGAGGG + Exonic