ID: 1138085404

View in Genome Browser
Species Human (GRCh38)
Location 16:54129189-54129211
Sequence TAGGACAGAAAGAAGACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138085402_1138085404 -4 Left 1138085402 16:54129170-54129192 CCACTTCTGACAGAGGGGCTAGG No data
Right 1138085404 16:54129189-54129211 TAGGACAGAAAGAAGACTGCTGG No data
1138085398_1138085404 14 Left 1138085398 16:54129152-54129174 CCTCAGGTCTGCGAGCGTCCACT No data
Right 1138085404 16:54129189-54129211 TAGGACAGAAAGAAGACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138085404 Original CRISPR TAGGACAGAAAGAAGACTGC TGG Intergenic
No off target data available for this crispr