ID: 1138085960

View in Genome Browser
Species Human (GRCh38)
Location 16:54134166-54134188
Sequence CTGTTTAAACACAGGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138085953_1138085960 -6 Left 1138085953 16:54134149-54134171 CCTCCCAGAAATGTTTGCTGTTT No data
Right 1138085960 16:54134166-54134188 CTGTTTAAACACAGGGAGGGAGG No data
1138085955_1138085960 -10 Left 1138085955 16:54134153-54134175 CCAGAAATGTTTGCTGTTTAAAC No data
Right 1138085960 16:54134166-54134188 CTGTTTAAACACAGGGAGGGAGG No data
1138085954_1138085960 -9 Left 1138085954 16:54134152-54134174 CCCAGAAATGTTTGCTGTTTAAA No data
Right 1138085960 16:54134166-54134188 CTGTTTAAACACAGGGAGGGAGG No data
1138085952_1138085960 22 Left 1138085952 16:54134121-54134143 CCTCATTTACACTAACAAGAGAC No data
Right 1138085960 16:54134166-54134188 CTGTTTAAACACAGGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138085960 Original CRISPR CTGTTTAAACACAGGGAGGG AGG Intergenic
No off target data available for this crispr