ID: 1138088471

View in Genome Browser
Species Human (GRCh38)
Location 16:54155082-54155104
Sequence CAGTGAGGGCCCTGAGGATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138088464_1138088471 24 Left 1138088464 16:54155035-54155057 CCTCGTTCATGGGACAGATGTCT No data
Right 1138088471 16:54155082-54155104 CAGTGAGGGCCCTGAGGATATGG No data
1138088466_1138088471 -7 Left 1138088466 16:54155066-54155088 CCTACTGCATGCCAGGCAGTGAG No data
Right 1138088471 16:54155082-54155104 CAGTGAGGGCCCTGAGGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138088471 Original CRISPR CAGTGAGGGCCCTGAGGATA TGG Intergenic
No off target data available for this crispr