ID: 1138093389

View in Genome Browser
Species Human (GRCh38)
Location 16:54194338-54194360
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138093389_1138093400 18 Left 1138093389 16:54194338-54194360 CCCCGGGCCACACGGGCCATGGC No data
Right 1138093400 16:54194379-54194401 CCTACCCAGCAATTAAGCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138093389 Original CRISPR GCCATGGCCCGTGTGGCCCG GGG (reversed) Intergenic