ID: 1138094815

View in Genome Browser
Species Human (GRCh38)
Location 16:54203258-54203280
Sequence CCAATCTGTTACTCAAGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138094815_1138094823 20 Left 1138094815 16:54203258-54203280 CCAGGGCTTGAGTAACAGATTGG No data
Right 1138094823 16:54203301-54203323 TCTAAGGACCCTCTTAGAATGGG No data
1138094815_1138094822 19 Left 1138094815 16:54203258-54203280 CCAGGGCTTGAGTAACAGATTGG No data
Right 1138094822 16:54203300-54203322 ATCTAAGGACCCTCTTAGAATGG No data
1138094815_1138094825 27 Left 1138094815 16:54203258-54203280 CCAGGGCTTGAGTAACAGATTGG No data
Right 1138094825 16:54203308-54203330 ACCCTCTTAGAATGGGACATGGG No data
1138094815_1138094824 26 Left 1138094815 16:54203258-54203280 CCAGGGCTTGAGTAACAGATTGG No data
Right 1138094824 16:54203307-54203329 GACCCTCTTAGAATGGGACATGG No data
1138094815_1138094821 4 Left 1138094815 16:54203258-54203280 CCAGGGCTTGAGTAACAGATTGG No data
Right 1138094821 16:54203285-54203307 TCATTAAGAGGGCAAATCTAAGG No data
1138094815_1138094820 -7 Left 1138094815 16:54203258-54203280 CCAGGGCTTGAGTAACAGATTGG No data
Right 1138094820 16:54203274-54203296 AGATTGGGGATTCATTAAGAGGG No data
1138094815_1138094819 -8 Left 1138094815 16:54203258-54203280 CCAGGGCTTGAGTAACAGATTGG No data
Right 1138094819 16:54203273-54203295 CAGATTGGGGATTCATTAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138094815 Original CRISPR CCAATCTGTTACTCAAGCCC TGG (reversed) Intergenic
No off target data available for this crispr