ID: 1138099803

View in Genome Browser
Species Human (GRCh38)
Location 16:54243687-54243709
Sequence GCCACAGTGAATGCTGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138099803_1138099811 20 Left 1138099803 16:54243687-54243709 CCTTCCCCAGCATTCACTGTGGC No data
Right 1138099811 16:54243730-54243752 AACTAAAAAGATCTACGGTTGGG No data
1138099803_1138099812 24 Left 1138099803 16:54243687-54243709 CCTTCCCCAGCATTCACTGTGGC No data
Right 1138099812 16:54243734-54243756 AAAAAGATCTACGGTTGGGCTGG No data
1138099803_1138099813 25 Left 1138099803 16:54243687-54243709 CCTTCCCCAGCATTCACTGTGGC No data
Right 1138099813 16:54243735-54243757 AAAAGATCTACGGTTGGGCTGGG No data
1138099803_1138099810 19 Left 1138099803 16:54243687-54243709 CCTTCCCCAGCATTCACTGTGGC No data
Right 1138099810 16:54243729-54243751 TAACTAAAAAGATCTACGGTTGG No data
1138099803_1138099809 15 Left 1138099803 16:54243687-54243709 CCTTCCCCAGCATTCACTGTGGC No data
Right 1138099809 16:54243725-54243747 ATCTTAACTAAAAAGATCTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138099803 Original CRISPR GCCACAGTGAATGCTGGGGA AGG (reversed) Intergenic
No off target data available for this crispr