ID: 1138105385

View in Genome Browser
Species Human (GRCh38)
Location 16:54284923-54284945
Sequence AGCGCCACCACCAGTGGCCG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 123}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138105385_1138105392 7 Left 1138105385 16:54284923-54284945 CCACGGCCACTGGTGGTGGCGCT 0: 1
1: 0
2: 0
3: 6
4: 123
Right 1138105392 16:54284953-54284975 GACTCAGGACCGGTAGTGGCCGG 0: 1
1: 0
2: 0
3: 2
4: 65
1138105385_1138105389 -3 Left 1138105385 16:54284923-54284945 CCACGGCCACTGGTGGTGGCGCT 0: 1
1: 0
2: 0
3: 6
4: 123
Right 1138105389 16:54284943-54284965 GCTGGAGCCAGACTCAGGACCGG 0: 1
1: 0
2: 2
3: 28
4: 280
1138105385_1138105390 3 Left 1138105385 16:54284923-54284945 CCACGGCCACTGGTGGTGGCGCT 0: 1
1: 0
2: 0
3: 6
4: 123
Right 1138105390 16:54284949-54284971 GCCAGACTCAGGACCGGTAGTGG 0: 1
1: 0
2: 0
3: 4
4: 71
1138105385_1138105388 -8 Left 1138105385 16:54284923-54284945 CCACGGCCACTGGTGGTGGCGCT 0: 1
1: 0
2: 0
3: 6
4: 123
Right 1138105388 16:54284938-54284960 GTGGCGCTGGAGCCAGACTCAGG 0: 1
1: 0
2: 2
3: 25
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138105385 Original CRISPR AGCGCCACCACCAGTGGCCG TGG (reversed) Exonic
902361255 1:15943745-15943767 TGGGGCACCACCGGTGGCCGAGG + Intronic
902865354 1:19274178-19274200 CGCTCCACCACCGGTGGGCGCGG - Intergenic
903072226 1:20732112-20732134 CGCGCCCCCACACGTGGCCGCGG + Intronic
906033688 1:42738356-42738378 AGCCCCAGCCCCAGTGGCCTCGG - Intronic
907447404 1:54517652-54517674 AGCGGCAACAGCAGTGGCGGTGG + Intergenic
912572521 1:110634955-110634977 AGCTCCAGCCCCAGTGGCCCCGG + Intergenic
913962674 1:143352391-143352413 AGGGCTACCACCAGGGGCCTGGG - Intergenic
913963986 1:143359721-143359743 AGGGCTACCACCAGGGGCCTGGG + Intergenic
914057029 1:144177976-144177998 AGGGCTACCACCAGGGGCCTGGG - Intergenic
914058350 1:144185325-144185347 AGGGCTACCACCAGGGGCCTGGG + Intergenic
914120798 1:144781046-144781068 AGGGCTACCACCAGGGGCCTGGG - Intergenic
914122117 1:144788390-144788412 AGGGCTACCACCAGGGGCCTGGG + Intergenic
917291557 1:173477115-173477137 GGCGCCACCAACAGCGACCGCGG + Intergenic
918961491 1:191283366-191283388 ACTGCCACCACCAGTGCCTGAGG + Intergenic
924385000 1:243492029-243492051 AGCCCCACCACCAGGGGCAGCGG - Intronic
1062977789 10:1698374-1698396 AGAGCCCCCTCCAGTGGCTGTGG - Intronic
1067687443 10:48475680-48475702 ATCGCCACCACCACTGGGCCAGG + Intronic
1074188589 10:111116855-111116877 AGCGCCAACACCTGTCGCCTGGG - Intergenic
1076814991 10:132910240-132910262 AGCCCCACCCCCAGACGCCGAGG + Intronic
1077058741 11:608552-608574 AGCGTCACCATCAGTGGGTGAGG + Exonic
1080343956 11:31300137-31300159 AGAGCCACCACACCTGGCCGAGG + Intronic
1083635295 11:64117553-64117575 GGCGCCATCACCCGTGGCCATGG - Exonic
1084175571 11:67420663-67420685 AGCGCCACCTCCAGCGTCCTCGG - Exonic
1084198998 11:67543001-67543023 TGAGCCACCACCTGTGGCAGAGG - Intergenic
1086850380 11:91800511-91800533 AGAGGCACCACCAGCCGCCGAGG + Intergenic
1088330659 11:108647735-108647757 AGCTCCACCACCGGTGGCTGAGG + Intergenic
1089564434 11:119363588-119363610 AGAGCCACCACCTGGTGCCGGGG + Intronic
1093182178 12:15979284-15979306 AGCAGCACCAGCAGTGGCCCTGG - Intronic
1104885308 12:132104052-132104074 AGCGCCATGTCCAGTGGCCTGGG + Exonic
1105701931 13:22940520-22940542 AGCACCACCACCCATGGCTGTGG + Intergenic
1112164195 13:96900116-96900138 AGGGCCAACACCAGGGGCTGAGG + Intergenic
1112505235 13:99971119-99971141 ACCACCACCAACAGTGGCGGCGG - Exonic
1113651509 13:112036872-112036894 CGCGTCTCCACCAGTGGCCACGG + Intergenic
1113651538 13:112036979-112037001 CGCGTCTCCACCAGTGGCCACGG + Intergenic
1113651552 13:112037033-112037055 CGCGTCTCCACCAGTGGCCACGG + Intergenic
1113651581 13:112037140-112037162 CGCGTCTCCACCAGTGGCCACGG + Intergenic
1113651596 13:112037193-112037215 CGCGTCTCCACCAGTGGCCACGG + Intergenic
1113651610 13:112037247-112037269 CGCGTCTCCACCAGTGGCCACGG + Intergenic
1114269232 14:21091046-21091068 AGCGCCACCACCGGGAGCAGAGG - Exonic
1122807521 14:104267537-104267559 GGCACCACCCCCAGTGCCCGGGG - Intergenic
1122828945 14:104386367-104386389 GGCGCAACCACCAGGGGCCCAGG + Intergenic
1123034043 14:105464621-105464643 AGCGCCATGACCGGGGGCCGAGG - Intronic
1123499496 15:20867037-20867059 AGCGCCACCACTAGTGTCTTGGG - Intergenic
1123556748 15:21440767-21440789 AGCGCCACCACTAGTGTCTTGGG - Intergenic
1123592971 15:21878003-21878025 AGCGCCACCACTAGTGTCTTGGG - Intergenic
1124125838 15:26937548-26937570 AGAGGCACCAGCTGTGGCCGGGG + Intronic
1125757593 15:42073995-42074017 ACCACCACCATCAGTGGCAGGGG - Intronic
1130256697 15:82329176-82329198 TGCTCCACCACCTGTGGCCTGGG + Intergenic
1130598253 15:85260812-85260834 TGCTCCACCACCTGTGGCCTGGG - Intergenic
1202965091 15_KI270727v1_random:167956-167978 AGCGCCACCACTAGTGTCTTGGG - Intergenic
1132833807 16:1942690-1942712 AGGGCCAGCTCCTGTGGCCGGGG - Intronic
1136384169 16:29912270-29912292 AGGGGCACAGCCAGTGGCCGGGG - Intronic
1138105385 16:54284923-54284945 AGCGCCACCACCAGTGGCCGTGG - Exonic
1138228871 16:55323756-55323778 CGCGCCTCCCGCAGTGGCCGCGG - Exonic
1138474341 16:57261889-57261911 AGACTCACCACCAGTGGCCAGGG + Exonic
1139451091 16:67028891-67028913 AGCTCCACGCCGAGTGGCCGCGG + Intergenic
1141158161 16:81611146-81611168 AGCTACACCTCCAGTGGCCAGGG + Intronic
1142260110 16:89038891-89038913 AGCGTCACCACCCATGGCCTCGG - Intergenic
1142684656 17:1570962-1570984 GGCGCCACCACCCCAGGCCGAGG - Intronic
1144062782 17:11598700-11598722 CGCACCACCAGCAGCGGCCGCGG - Exonic
1144759551 17:17699730-17699752 ATCTCCACCAACTGTGGCCGGGG - Intronic
1146142292 17:30378821-30378843 AGCGTCACCACCAGGGGGCGGGG - Intergenic
1150380835 17:64718141-64718163 AGCCCCACCTCCAGTGGCATAGG + Intergenic
1152238228 17:79149389-79149411 AGAGCCACCAGGAGGGGCCGGGG - Intronic
1152846612 17:82604028-82604050 AGCTCCAGCACCAGGGGCCAGGG - Exonic
1155062530 18:22241563-22241585 AGCGCAGCCACCAAGGGCCGGGG - Intergenic
1163103509 19:15110640-15110662 CGCTCCACCAGCAGTGGCAGGGG - Exonic
1163518471 19:17778775-17778797 GGCGCCACCCCCAGAGGCCAGGG + Exonic
1164057634 19:21635187-21635209 GGCGGCAGCAGCAGTGGCCGAGG - Intergenic
1164615247 19:29663810-29663832 AGGGCCACCAGCTGTGGCCTTGG - Intergenic
1165093713 19:33399535-33399557 AGAGCCCCCACCAGAGGCTGAGG - Intronic
1166983860 19:46648602-46648624 TGCTCCACCCCCAGAGGCCGCGG + Exonic
1168092711 19:54096123-54096145 AGCGCCACCAGCGACGGCCGCGG + Exonic
1168694475 19:58396783-58396805 AGCGCCACGAGCTGGGGCCGCGG - Exonic
1202696512 1_KI270712v1_random:130649-130671 AGGGCTACCACCAGGGGCCTGGG - Intergenic
1202697831 1_KI270712v1_random:137982-138004 AGGGCTACCACCAGGGGCCTGGG + Intergenic
925215870 2:2095541-2095563 CGAGCCCCCACCTGTGGCCGCGG + Intronic
931249048 2:60514266-60514288 TGCGATCCCACCAGTGGCCGGGG - Intronic
934277674 2:91587674-91587696 AGGGCTACCACCAGGGGCCTGGG - Intergenic
934279002 2:91594978-91595000 AGGGCTACCACCAGGGGCCTGGG + Intergenic
935570621 2:104656968-104656990 AGCACCACCACCACTCGCCAAGG - Intergenic
939817022 2:146908930-146908952 AGCACCGCCACCATTGGCCCAGG + Intergenic
943351856 2:186805822-186805844 AGAGCCACTACCAGTGGCTATGG + Intergenic
946782506 2:223205757-223205779 AGTGCCAGCAGCAGTGGCAGTGG - Intergenic
947590438 2:231382227-231382249 GGCTCCATGACCAGTGGCCGTGG + Intergenic
948402011 2:237691761-237691783 AGCTCCACCCGCAGGGGCCGTGG - Intronic
948997964 2:241593606-241593628 AGTGTCTCTACCAGTGGCCGTGG + Intronic
1169469542 20:5871907-5871929 AGAGCCACACCCAGTGGCAGTGG + Intergenic
1172245700 20:33443739-33443761 AGCTCCTCCCCCAGCGGCCGGGG - Exonic
1173672709 20:44809763-44809785 CGCGCCACCTCCAATGGCGGGGG + Intronic
1174884674 20:54320193-54320215 AGTGCCACCAGCTGTGGCCCTGG + Intergenic
1175346133 20:58277777-58277799 AGGGCCATCAGCAGTGGCCTGGG + Intergenic
1175443634 20:59006737-59006759 AGGGCCACCCCCAGAGGCCGAGG + Intronic
1181811303 22:25405228-25405250 AGCGCCAGCAGCAGCGGCCACGG + Intronic
1183338940 22:37267351-37267373 AGCACGGCCACGAGTGGCCGAGG - Intergenic
1183978280 22:41525606-41525628 AGAGCCACCTCCAGTGGGTGTGG + Intronic
1184643249 22:45883183-45883205 TGAGCCACGCCCAGTGGCCGTGG + Intergenic
1185048650 22:48541809-48541831 AGTGCCACCACCCGTGCCCTGGG + Intronic
950940413 3:16885162-16885184 AGCGCGCCCGCCCGTGGCCGAGG - Intronic
953911785 3:46896873-46896895 ATCTCCCCCAGCAGTGGCCGTGG + Intronic
954411194 3:50371938-50371960 AGAGCCACCTCCAGTGGCCAGGG - Intronic
954800015 3:53181618-53181640 TGCACCACCACCAGTGGGCATGG - Intronic
954806701 3:53224809-53224831 GGGGACTCCACCAGTGGCCGGGG + Intronic
975401498 4:73944275-73944297 AGCGCCGCCCGCAGTAGCCGGGG + Intergenic
975409998 4:74038553-74038575 AGCGCCACCCGCAGGAGCCGGGG + Exonic
975415386 4:74099062-74099084 AGCGCCACCCGCAGGAGCCGGGG + Exonic
978749676 4:112232252-112232274 ACCGCCACCTCCAGCCGCCGGGG - Intronic
983238713 4:165207718-165207740 CGCGCCACCACCTGCGGCGGCGG - Intronic
985622901 5:964897-964919 AGCCACGCCACGAGTGGCCGAGG + Intergenic
985643877 5:1076062-1076084 AGCGGCCTCACCAGTGGCAGAGG + Intronic
985725544 5:1514115-1514137 ACCCCCACCACCAGCGGCTGGGG + Intronic
985951582 5:3225528-3225550 AGCTCCACCTCAAGTGGCTGTGG - Intergenic
986202199 5:5588859-5588881 AGAGCCACCACCAGAGCCCAGGG + Intergenic
986758161 5:10856778-10856800 AGAGCCACCACCAGCTGCAGTGG + Intergenic
994061738 5:95486256-95486278 AGCTCCAGCAGCAGTGGCTGTGG - Intronic
995183289 5:109248554-109248576 AGGTCCCCCACCAGTGCCCGGGG - Intergenic
1002863078 6:1097073-1097095 AGCTCCACCACCTGGGGCCGTGG - Intergenic
1003787329 6:9501294-9501316 AGCGCCACGACAATTGGCCATGG + Intergenic
1004815007 6:19303342-19303364 AGAGCCAACGCCAGTGGCAGAGG + Intergenic
1004981561 6:21030314-21030336 ACCTCCACTACCAGTGGCCCTGG - Intronic
1006058599 6:31403587-31403609 AGCGGCTCAAGCAGTGGCCGGGG - Exonic
1007371225 6:41428024-41428046 AGAGCCACCACCAGCGGTAGCGG - Intergenic
1014079129 6:117268230-117268252 AGCCCCAGCAGCAGTGGCAGCGG + Exonic
1017253371 6:152306200-152306222 TGAGCCACCACGACTGGCCGGGG - Intronic
1021101094 7:16586543-16586565 AGCAGCACCACGAGAGGCCGGGG - Intergenic
1021410953 7:20330102-20330124 AGAGCCACCACCAGACGCTGGGG + Intergenic
1022018418 7:26376114-26376136 AGCGCCACCGCCAGTGGGGTGGG - Intergenic
1031433723 7:121706633-121706655 AGCTCCATCCTCAGTGGCCGGGG + Intergenic
1040599325 8:48869200-48869222 AGTGGCACCAGCAGTGGACGGGG + Intergenic
1049411928 8:142477423-142477445 TGCTCCAGCACCTGTGGCCGTGG + Exonic