ID: 1138105387

View in Genome Browser
Species Human (GRCh38)
Location 16:54284929-54284951
Sequence GGCTCCAGCGCCACCACCAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 201}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138105387_1138105392 1 Left 1138105387 16:54284929-54284951 CCACTGGTGGTGGCGCTGGAGCC 0: 1
1: 0
2: 1
3: 14
4: 201
Right 1138105392 16:54284953-54284975 GACTCAGGACCGGTAGTGGCCGG 0: 1
1: 0
2: 0
3: 2
4: 65
1138105387_1138105390 -3 Left 1138105387 16:54284929-54284951 CCACTGGTGGTGGCGCTGGAGCC 0: 1
1: 0
2: 1
3: 14
4: 201
Right 1138105390 16:54284949-54284971 GCCAGACTCAGGACCGGTAGTGG 0: 1
1: 0
2: 0
3: 4
4: 71
1138105387_1138105389 -9 Left 1138105387 16:54284929-54284951 CCACTGGTGGTGGCGCTGGAGCC 0: 1
1: 0
2: 1
3: 14
4: 201
Right 1138105389 16:54284943-54284965 GCTGGAGCCAGACTCAGGACCGG 0: 1
1: 0
2: 2
3: 28
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138105387 Original CRISPR GGCTCCAGCGCCACCACCAG TGG (reversed) Exonic
901916573 1:12504922-12504944 GCCCCCAGCGCCACCACCCTGGG - Intronic
903389331 1:22953290-22953312 GGCACCAGCGCCTCCACGCGCGG + Exonic
904534148 1:31188171-31188193 CGCTCCAGCGCAGCCACCTGTGG + Exonic
904607137 1:31704138-31704160 GGCTCCAGCGGCACCAGAGGCGG + Exonic
912475207 1:109930345-109930367 GGCCTCAGAGCCACCACCACAGG - Exonic
912507501 1:110166262-110166284 GGCTCTTGAGCCATCACCAGGGG - Intronic
913969430 1:143403327-143403349 GGATCTAGGGCCACCATCAGGGG + Intergenic
914063807 1:144228926-144228948 GGATCTAGGGCCACCATCAGGGG + Intergenic
914115343 1:144737428-144737450 GGATCTAGGGCCACCATCAGGGG - Intergenic
915069182 1:153252022-153252044 GGGGCCAGCTCCACCACCAGGGG + Intergenic
919792633 1:201302015-201302037 GGCTCGAAAGCCACCACCTGCGG - Intronic
920110277 1:203582708-203582730 GGCCCCAGTGCCAGCACCATGGG - Intergenic
921289361 1:213641965-213641987 GGGGCCAGGGCCACCACCATAGG + Intergenic
922534851 1:226372167-226372189 GGCTTCATCCCCAGCACCAGGGG - Intronic
1063428665 10:5968795-5968817 GCCCCCAGTGCCACCACCATCGG - Intronic
1066276244 10:33871358-33871380 GGGTCCAGCCCCATCATCAGAGG - Intergenic
1067054596 10:43043444-43043466 GGCTGCAGCCCCTCCAACAGTGG - Intergenic
1067526918 10:47044740-47044762 GGCTCCAGCCCCAGTGCCAGGGG + Intergenic
1067527795 10:47048751-47048773 GGCTCCAGCGCCCTCCTCAGGGG - Intergenic
1069639060 10:69943471-69943493 GGCTCCAGCGCCCCCAGCCCCGG + Intronic
1069884579 10:71615703-71615725 GCTTCCGGCGCCACCACCGGGGG - Intronic
1070735537 10:78861454-78861476 GGCTCCAGCTGCAGCACCTGGGG - Intergenic
1073186811 10:101619950-101619972 GGCACCAGCGCTCCCATCAGGGG - Intronic
1073353349 10:102835215-102835237 GGATCCAGCCCCAGCCCCAGGGG + Intronic
1074779182 10:116788241-116788263 TTCACCAGCTCCACCACCAGAGG - Intergenic
1075746936 10:124734617-124734639 CGCTCTAGGGCCAGCACCAGAGG + Intronic
1076995109 11:293957-293979 GGCTCCACTCCCACCACAAGGGG - Intronic
1077077332 11:707566-707588 GGCTTCGTCCCCACCACCAGTGG + Intronic
1077121529 11:911017-911039 AGCTCCAGCGCGAGCACCAGGGG - Intronic
1078771929 11:14359155-14359177 GCCTCCAGCGCCGCCACAAATGG + Exonic
1081528975 11:43944938-43944960 CGCACCAGCCCCACCACCAGAGG - Intergenic
1082810212 11:57474974-57474996 GGCATCAGCTCCACCCCCAGAGG - Intronic
1083430965 11:62613297-62613319 GGCTGCAGGGGCAGCACCAGGGG - Exonic
1084360028 11:68663325-68663347 GGCAGCAGGGCCACCACCTGGGG + Intergenic
1085266804 11:75242163-75242185 GGCTCCCGCGCCACCTCCCCGGG + Exonic
1089652035 11:119920743-119920765 GGCTCCTGGGCCAGCAGCAGTGG + Intergenic
1090394657 11:126410883-126410905 GGCTCCAGCACCACCTCCTCTGG - Intronic
1091256083 11:134187201-134187223 GTCTCCATGGCCTCCACCAGAGG + Intronic
1092508001 12:9124477-9124499 GGCTGCAGCACCCCGACCAGTGG + Intergenic
1092779078 12:11968700-11968722 GGCCCCACCTCCACCACCATGGG - Intergenic
1096196492 12:49651996-49652018 GGCTCCAGCCCCACCCCCTGAGG - Exonic
1096601277 12:52731534-52731556 GGCTACAGCATCACCACCAAAGG + Intergenic
1104639662 12:130459395-130459417 GGCTACAGAGACACCACCACCGG + Intronic
1104945656 12:132413903-132413925 GGCTCCAGCACCAGGACCTGGGG + Intergenic
1109136124 13:58653715-58653737 GGTACCAGCACCAGCACCAGTGG + Intergenic
1110544815 13:76744516-76744538 GGCTCCAGCCCAAACATCAGCGG + Intergenic
1112505237 13:99971125-99971147 GGCTACACCACCACCAACAGTGG - Exonic
1118503249 14:66383458-66383480 TGCTACACAGCCACCACCAGGGG + Intergenic
1120236950 14:81903403-81903425 GGCTCCAGGCCCAGCCCCAGTGG - Intergenic
1121228838 14:92341593-92341615 GGCTGCAGGGCCTCCACCTGGGG + Intronic
1122593389 14:102871415-102871437 GGCTCCAGCCCCTCCTCCACCGG - Intronic
1122634218 14:103122749-103122771 GGGTCCAGCCCCAGCCCCAGAGG + Intergenic
1124683299 15:31756016-31756038 GACTCCAGCCTCACCTCCAGTGG + Intronic
1125508212 15:40279553-40279575 GGGCCCAGCGCTGCCACCAGGGG + Intronic
1128083585 15:64871113-64871135 GCCTCCAGCCCCAAGACCAGAGG - Intronic
1128484301 15:68069657-68069679 GGCTCCCGCGCCACCACGCCCGG - Intronic
1128728656 15:70006250-70006272 GGCCCCAGCCCTGCCACCAGGGG + Intergenic
1129463945 15:75713299-75713321 GACTCCAGAGGCACCACCCGAGG + Intergenic
1130223829 15:82043753-82043775 GGCTCCCGCTCCCCCACCTGGGG - Exonic
1130979820 15:88804589-88804611 GGCTCCTGCTCCACCAGCATTGG - Intronic
1131260078 15:90883601-90883623 GGCACCAGCTCCTCCACTAGGGG - Intergenic
1131466002 15:92655439-92655461 AGCTCCAGCTCCAACAGCAGTGG - Exonic
1132698094 16:1210781-1210803 AGCCCCAGGGCCACCACCTGCGG - Exonic
1133234679 16:4382313-4382335 GGCTGCAGCGCTACCTCCAGGGG + Exonic
1134086138 16:11358716-11358738 GGCTCCAGGGTCCCCACCAGAGG - Intergenic
1135040739 16:19115008-19115030 GGCTCCAGCGCCACAAGCGGCGG - Exonic
1135588896 16:23691364-23691386 GCCTCCAGTGCCCTCACCAGGGG + Exonic
1137619484 16:49867068-49867090 GGCTCCAGGGCCTCTCCCAGTGG - Intergenic
1138060717 16:53887404-53887426 GGCTCCAGCTCCAATGCCAGGGG - Intronic
1138105387 16:54284929-54284951 GGCTCCAGCGCCACCACCAGTGG - Exonic
1138228844 16:55323680-55323702 CTCTCCAGCGCCACCCCCAGCGG + Intergenic
1139511650 16:67431345-67431367 AGCGCCAGCGCCGCCAGCAGCGG - Exonic
1139534453 16:67562811-67562833 GGCGCCAGCGCCGCCGCCGGGGG + Intronic
1139659320 16:68410120-68410142 GTCTCCAGCTCCACCGCAAGAGG + Intronic
1140210031 16:72962445-72962467 GGCTCTAGTGTCACCACCACAGG - Intronic
1141550960 16:84806487-84806509 GGCATCACCGCCACCATCAGGGG - Intergenic
1142897505 17:2991418-2991440 GGCTCCAGCTCCATCAACAAGGG + Intronic
1143473633 17:7191186-7191208 AGCTCCCCCGCCACCCCCAGTGG - Intronic
1144364489 17:14529152-14529174 GACCCCACCGCCACCACCACAGG - Intergenic
1144574369 17:16419750-16419772 AGCTCAAGAGCCACCACAAGTGG + Intronic
1151345928 17:73501082-73501104 GGCTCCAGCACTAACACTAGAGG + Intronic
1152072603 17:78141206-78141228 GGCTCCAGGGCCTCCCTCAGAGG + Exonic
1152444969 17:80337201-80337223 GCTTCCAGCGTCACCCCCAGAGG + Intronic
1152846614 17:82604034-82604056 TGCTGCAGCTCCAGCACCAGGGG - Exonic
1155491836 18:26407567-26407589 GGCTCCAGGTCCAGTACCAGAGG - Intergenic
1159878410 18:73834942-73834964 CTCTCCGGCACCACCACCAGTGG + Intergenic
1160029822 18:75249233-75249255 GGCTCCGGGGTCTCCACCAGAGG - Intronic
1160751476 19:736392-736414 GGCGTGAGCGCCACCCCCAGCGG - Intronic
1160780787 19:877122-877144 AGCGCCAGCCCCACCTCCAGCGG + Exonic
1161766892 19:6213246-6213268 GGCTCCTGGGGCAGCACCAGGGG + Intronic
1162818433 19:13209376-13209398 AGAACCAGCGGCACCACCAGCGG - Exonic
1163103514 19:15110646-15110668 CGCTCCCGCTCCACCAGCAGTGG - Exonic
1163162942 19:15476281-15476303 GCCTCCAGCCCCGCCAGCAGAGG + Exonic
1163585470 19:18161290-18161312 GGCTCCAGCGCCGGCCCCACGGG - Exonic
1165093716 19:33399541-33399563 GCCTCCAGAGCCCCCACCAGAGG - Intronic
1165744894 19:38224675-38224697 GGCTCCAGAGACCCCACCCGGGG + Intronic
1165808017 19:38593660-38593682 GGCTCCAGTGGCACGCCCAGTGG - Intronic
1166091694 19:40513328-40513350 ACCTGCAGCGCCACCACCAGTGG - Exonic
1166299122 19:41904252-41904274 TGCTCCAGCGCCAGGACGAGCGG + Exonic
1166766914 19:45256612-45256634 GGCTCCTCCTCCACCACCACTGG - Intronic
1168719977 19:58549506-58549528 GGTTCCCGGGCCACCACCTGGGG - Exonic
925445956 2:3927220-3927242 GGCTCCTGTGCTCCCACCAGGGG + Intergenic
925921115 2:8638548-8638570 GGCCCCACCGCCAGCTCCAGCGG - Intergenic
926142072 2:10373752-10373774 GCCACCAGCACCACCCCCAGAGG + Intronic
926327304 2:11796601-11796623 GGCACCTGGGACACCACCAGGGG - Intronic
927510548 2:23641438-23641460 GGCTCTAGCGCCCTCACCTGAGG + Intronic
928387567 2:30883347-30883369 TGCTCCAGCTCCTCCAGCAGAGG - Intergenic
929899209 2:45986786-45986808 GGCTCCGCCCCCACCTCCAGGGG - Intronic
934174123 2:89564230-89564252 GGATCTAGGGCCACCATCAGGGG + Intergenic
934284438 2:91638579-91638601 GGATCTAGGGCCACCATCAGGGG + Intergenic
935080896 2:99793054-99793076 GGCCCCACCTCCAACACCAGGGG - Intronic
935820063 2:106886037-106886059 GGCTGCAGCGCCACCAAGAAAGG + Intronic
937255440 2:120552218-120552240 TGCTCCGGCGCTACCTCCAGGGG + Intergenic
937293703 2:120797431-120797453 GGCTGCAGCGGCAGCAGCAGCGG + Exonic
944921742 2:204421301-204421323 GCCTCCACCTCCACCTCCAGAGG + Intergenic
946415454 2:219537815-219537837 GGCTCCAGGGCCCCCTCCACAGG - Intronic
947593818 2:231398972-231398994 GGCTCCAGCCCCAATACCATGGG - Exonic
948395234 2:237640502-237640524 GTCTCCAGCCCCACCTCCACAGG - Intronic
948481380 2:238252542-238252564 GGCTCCGGCGCCACACCCTGAGG + Intronic
948481447 2:238253005-238253027 GGCTCCAGTGCCACCCTCAGGGG + Exonic
1170892641 20:20389100-20389122 GGCTTCAGCCATACCACCAGGGG + Intergenic
1171237778 20:23541515-23541537 GGATCCAGCCCCCTCACCAGAGG - Intergenic
1172614596 20:36274886-36274908 GGCTCCAGAGCCTCCACCTAGGG - Intergenic
1172804083 20:37598583-37598605 GGCTCCCCCGCCCCCACCCGTGG - Intergenic
1174337075 20:49870375-49870397 GGCTCCAGTGCCACCTCCAGGGG - Intronic
1176183913 20:63767628-63767650 GGCTCCAGCGCACAGACCAGAGG + Intronic
1180875121 22:19171597-19171619 GGCTCCAGCCCCAGCAGCAACGG + Intergenic
1181134133 22:20752290-20752312 GGCAGCAGCGCCACCACAGGTGG - Intronic
1183431002 22:37765728-37765750 AGCTGCAGCGGCACCACGAGCGG + Exonic
1183685429 22:39358891-39358913 GGCCCCTGCTCCACCAGCAGCGG - Intronic
1183998805 22:41656795-41656817 GGCCCCAGCCCCAGCACCACAGG + Intronic
1184383059 22:44158383-44158405 TGCTGCAGCTCCACCACCTGTGG + Intronic
950660151 3:14462096-14462118 GCCTGCTGGGCCACCACCAGAGG + Intronic
950787735 3:15450095-15450117 GGCCCCACCCCCACCACCAACGG + Intronic
953741157 3:45540543-45540565 AGTTCCACCTCCACCACCAGTGG + Intronic
953880340 3:46688069-46688091 AGCCCCAGCCCCACCTCCAGTGG + Intronic
954174964 3:48837177-48837199 GGCTCATGCGCCACCATAAGTGG - Intronic
954965826 3:54610016-54610038 GGATCGATAGCCACCACCAGAGG - Intronic
956754769 3:72373716-72373738 GGTACCAGTGCCACCAGCAGTGG + Exonic
960906103 3:122603180-122603202 GGATCCAGGGCCACCAGGAGTGG - Intronic
961817808 3:129560266-129560288 GGCTCCAGCCCCAGCTCCAGAGG - Intronic
965295684 3:166942926-166942948 GGAAACAGAGCCACCACCAGTGG - Intergenic
966600816 3:181773459-181773481 GGCTCAAAAACCACCACCAGTGG - Intergenic
968090479 3:195895691-195895713 GGCCCCAGAGCCACCAACTGGGG + Intronic
968106433 3:196004938-196004960 GGCTCCAACTCCACCACCCTCGG + Intergenic
968451658 4:678836-678858 GGCTCCAGGGCCAGCAGGAGTGG + Intronic
968514233 4:1009725-1009747 GGCGCCGCCGCCACCGCCAGAGG + Intergenic
968604896 4:1530497-1530519 AGCCCCAGCCCCAGCACCAGGGG - Intergenic
968702732 4:2064516-2064538 GGCCCCAGCGCCACTGCCTGTGG + Exonic
968881819 4:3304545-3304567 GGCTCCAGCACCACGACTGGAGG - Intronic
969297368 4:6277887-6277909 GGCACCAGCACCACCTCGAGTGG - Intronic
969827975 4:9773174-9773196 GGCTCTAGGGCCACCATCAGGGG + Intronic
971199663 4:24500497-24500519 GGCTCCAGAGCCAGAAACAGCGG + Intergenic
971436739 4:26634103-26634125 GGCTGTAGCTACACCACCAGAGG - Intronic
974094804 4:57351390-57351412 GGAACCAGAGCCACCAGCAGTGG + Intergenic
984466173 4:180101772-180101794 GGCTGCAGCTCCAGCAACAGTGG - Intergenic
985759972 5:1743728-1743750 GGACCCAGTGCCACCAACAGGGG + Intergenic
987374422 5:17219655-17219677 GCCTCCAGTGACACCACCTGGGG + Intronic
987411680 5:17620985-17621007 GACTCCAGCGCCGCCTGCAGTGG - Intergenic
988916841 5:35903132-35903154 GTCTCCAGCACCATAACCAGAGG + Intergenic
996765434 5:127030670-127030692 GGTCCCAGCGCCACCACGACTGG - Exonic
998258486 5:140609157-140609179 GGCTCAGTCGCCACCACCATGGG + Intergenic
1002401730 5:178994895-178994917 GGCAGCAGCGCCACGAGCAGCGG + Exonic
1002984800 6:2178543-2178565 GGCTCTACCTCCAACACCAGGGG + Intronic
1004062581 6:12212322-12212344 GGCTACTGCACCACCACCACTGG - Intergenic
1005040225 6:21594643-21594665 GGCTCCACCGCCTCCACGGGCGG + Exonic
1006003694 6:30986590-30986612 GACTCCAGCACAACCTCCAGTGG + Exonic
1006003797 6:30987130-30987152 GACTCCAGCACAACCTCCAGTGG + Exonic
1006003826 6:30987265-30987287 GGGTCCAGCACGACCTCCAGTGG + Exonic
1007371226 6:41428030-41428052 AGGTCGAGAGCCACCACCAGCGG - Intergenic
1007432867 6:41786596-41786618 GGGTCCCCCGCCTCCACCAGAGG - Intronic
1010204542 6:73310417-73310439 GCCTACAGCGCCGCCACCTGGGG + Intergenic
1010509856 6:76704981-76705003 GGGTCCCGCACCACCCCCAGAGG + Intergenic
1015840838 6:137475305-137475327 AGCTACAGCGCCTCCACCTGGGG - Intergenic
1016680234 6:146820652-146820674 GGCCCCAGAGCCAGCAACAGGGG - Intergenic
1019572329 7:1719066-1719088 GCCTCCATCTCCACCCCCAGGGG + Intronic
1019650891 7:2157640-2157662 GGCTGGAGCTCCACCACCACTGG + Intronic
1022440731 7:30430811-30430833 GGCTGCAGCCCAGCCACCAGTGG - Intronic
1024530841 7:50391452-50391474 GGCACCACCACCATCACCAGAGG - Intronic
1024643568 7:51352443-51352465 GCTTCCAGAGCCACTACCAGTGG + Intergenic
1025840398 7:65141251-65141273 GGCCCCTGCGCCACCCTCAGCGG - Intergenic
1025878316 7:65508913-65508935 GGCCCCTGCGCCACCCTCAGCGG + Intergenic
1025882659 7:65554713-65554735 GGCCCCTGCGCCACCCTCAGCGG + Intergenic
1025890784 7:65647890-65647912 GGCCCCTGCGCCACCCTCAGCGG - Exonic
1027539662 7:79452592-79452614 GGGTGCAGCGGCATCACCAGCGG - Intronic
1028229293 7:88287307-88287329 GCCTCCAGATCCATCACCAGAGG + Intronic
1030532077 7:110723711-110723733 GGCTCCATGGCCATAACCAGAGG - Intronic
1034557233 7:151858012-151858034 GGCCACAGCACCACCAGCAGTGG - Intronic
1035444332 7:158929515-158929537 GGCTCCCACGCCACCGCCTGTGG - Intronic
1036757708 8:11482258-11482280 GGCCCCAGAGCCACCTGCAGGGG - Intergenic
1037458363 8:19084847-19084869 GTCTCCAGCGGCAACCCCAGGGG - Intergenic
1037721161 8:21445207-21445229 TGCTCCAGGGCCCCCACCTGGGG + Intergenic
1038124336 8:24654722-24654744 GGCCACAGCCCCACCAACAGTGG + Intergenic
1038348623 8:26755769-26755791 TGCTCCAGCGCCAAGTCCAGGGG - Intronic
1039464928 8:37778078-37778100 TGCTCCTGTGCCACCTCCAGCGG - Exonic
1039811578 8:41053947-41053969 GCCTCCAGGGCCACCCCAAGGGG + Intergenic
1042328786 8:67556263-67556285 GACTCCAGCCCCAAGACCAGTGG - Intronic
1046487668 8:114908715-114908737 GGCTGCAGCTCCAACAACAGAGG + Intergenic
1049199922 8:141334977-141334999 GGCCCCAGCTCCAACACCTGAGG - Intergenic
1049552251 8:143265855-143265877 GGTCCCACCGCCACCATCAGGGG + Intronic
1049710220 8:144060028-144060050 GACTCCAGCCCCACCACCATGGG - Exonic
1049738190 8:144221227-144221249 GGCATCAGCTCCACCTCCAGAGG - Intronic
1050343772 9:4666225-4666247 AGCTCCACCACCACCTCCAGAGG + Exonic
1050878996 9:10675660-10675682 GGCTGCAGCTCCAGCAACAGGGG - Intergenic
1054719903 9:68594126-68594148 GGCTTCAGCCCCATCTCCAGGGG + Intergenic
1057332304 9:94127432-94127454 GGCTCCACCTCCAACACTAGGGG - Intergenic
1060521422 9:124296194-124296216 AGCACCAGTGCCAGCACCAGGGG - Intronic
1061626286 9:131842545-131842567 GGCTCCGGTGCCACAGCCAGCGG - Intergenic
1061993143 9:134170938-134170960 GGCTCCAGCTCCACCCTGAGCGG - Intergenic
1062013210 9:134277872-134277894 GGCTCCTGCACAACCAGCAGGGG + Intergenic
1062095688 9:134702020-134702042 GACTCCAACGCCCCCACCCGGGG - Intronic
1062262560 9:135670240-135670262 GGCTCCAGGGACCCCAGCAGTGG + Intergenic
1062556962 9:137117426-137117448 GGCTGCAGAGCCACCAGCTGAGG + Intergenic
1062718543 9:138023189-138023211 CGGCCCAGCTCCACCACCAGCGG - Exonic
1190303001 X:49067325-49067347 GGAGCCAGCTCCCCCACCAGCGG - Exonic
1196400526 X:115311785-115311807 GCCGCCAGCGCCACCAGCTGTGG + Intergenic
1199976008 X:152895313-152895335 GGCAGCAGTGCCACCTCCAGGGG - Intergenic