ID: 1138105389

View in Genome Browser
Species Human (GRCh38)
Location 16:54284943-54284965
Sequence GCTGGAGCCAGACTCAGGAC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 280}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138105387_1138105389 -9 Left 1138105387 16:54284929-54284951 CCACTGGTGGTGGCGCTGGAGCC 0: 1
1: 0
2: 1
3: 14
4: 201
Right 1138105389 16:54284943-54284965 GCTGGAGCCAGACTCAGGACCGG 0: 1
1: 0
2: 2
3: 28
4: 280
1138105385_1138105389 -3 Left 1138105385 16:54284923-54284945 CCACGGCCACTGGTGGTGGCGCT 0: 1
1: 0
2: 0
3: 6
4: 123
Right 1138105389 16:54284943-54284965 GCTGGAGCCAGACTCAGGACCGG 0: 1
1: 0
2: 2
3: 28
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138105389 Original CRISPR GCTGGAGCCAGACTCAGGAC CGG Exonic
900187341 1:1338573-1338595 GCAGCTGCCAGACTCGGGACTGG - Exonic
900326320 1:2110294-2110316 GCTGGAGGCAGATTCAGCCCTGG - Intronic
900341395 1:2190977-2190999 GCTGGAGCCAGCCCCGGGAGTGG - Intronic
900516947 1:3086635-3086657 GCAGCAGCCAGACCCAGGCCCGG + Intronic
900706437 1:4083081-4083103 GCAGGAGGGAGACTGAGGACCGG + Intergenic
900750990 1:4397321-4397343 GCTGGAGCCAGGGCCAGGGCAGG + Intergenic
901473699 1:9474771-9474793 GCTGGAGACAGGCTGAGGTCCGG - Intergenic
902560746 1:17275991-17276013 GCATGAGGCAGACTCAGGACAGG - Intronic
903188426 1:21642505-21642527 CCTGGAGCCAGAGTCTGGGCTGG - Intronic
903471207 1:23588663-23588685 GATGGAGCCAGCCACAGGGCTGG - Intronic
904396684 1:30227254-30227276 GCTGGAGGCAGTCACAGGTCTGG - Intergenic
905319566 1:37106265-37106287 GCAGGAGCCAGAGTCAGGGAGGG - Intergenic
905348081 1:37325094-37325116 CTGGGATCCAGACTCAGGACAGG - Intergenic
906636103 1:47411790-47411812 GCCTGAGCCAGGCTCAGGAAAGG - Intergenic
908403389 1:63791310-63791332 GCTGGAGACAGAATCAGGAAAGG + Intronic
909104406 1:71391122-71391144 GCTGAAGGCATACTCAAGACTGG - Intergenic
912747104 1:112254005-112254027 CCTGGACCCAGACACAGGACTGG - Intergenic
914998585 1:152566111-152566133 GCTGGAGGCAGACACTGTACTGG + Exonic
914999938 1:152579839-152579861 GCTGGAGGCAGACACTGTACTGG + Exonic
916351857 1:163859459-163859481 TCTGCAGCAAGAGTCAGGACTGG + Intergenic
919464174 1:197911386-197911408 GATGCAGCCAGACCCGGGACGGG - Intergenic
921436484 1:215129471-215129493 GATGGAGCCAGAGTAAGGAGTGG + Intronic
924139101 1:241003696-241003718 GCTGGAGGCAGATACAGGAGTGG - Intronic
924881301 1:248164936-248164958 ACTGGAGCCACCCTGAGGACTGG - Intergenic
1062900794 10:1144272-1144294 CCTGGAGCCAGCCACAGGATAGG - Intergenic
1067268234 10:44766238-44766260 CCTGGAGCCAGACTCCATACAGG - Intergenic
1067385256 10:45812778-45812800 GCAGGAGCCAGAGTCAGCATGGG - Intergenic
1067459338 10:46445898-46445920 ACTGGCCCCACACTCAGGACTGG - Intergenic
1067627856 10:47938732-47938754 ACTGGCCCCACACTCAGGACTGG + Intergenic
1067756467 10:49009394-49009416 TTTGGCACCAGACTCAGGACTGG - Intergenic
1069298525 10:66877434-66877456 GCTGGAGCCAGCATCAGAGCTGG - Intronic
1069626798 10:69873128-69873150 ACTGGTGCCAGCCTCAGGCCAGG - Intronic
1069638815 10:69942000-69942022 GCTGGAGCCACCCTCAGGGGAGG + Intronic
1069828271 10:71267510-71267532 GCTGGAGGCAGACTGGGCACTGG + Intronic
1071456054 10:85852450-85852472 CCTGGCGCCAGGCACAGGACTGG + Intronic
1072250377 10:93577538-93577560 GCAGGAGGCAGATTCAGGCCTGG + Intronic
1072861130 10:99006771-99006793 GCTGGTACCAGTCTCAGGCCTGG + Intronic
1073293861 10:102426588-102426610 GCAGAAGCCAGACTCAGGATAGG - Intronic
1074283017 10:112070846-112070868 CCTGGAGGCTGACTTAGGACAGG + Intergenic
1075781135 10:125017954-125017976 TCTGGAGCAAGAGTCATGACGGG - Intronic
1076590746 10:131580450-131580472 GCTGGAGCCAGAAGCAGCTCAGG + Intergenic
1077133961 11:989411-989433 GCTGGAGCCTCACTCAGACCTGG - Intronic
1077218695 11:1405758-1405780 GCTGGGGCCACACTCAGGAAAGG - Intronic
1077274251 11:1696123-1696145 GCAGGACCCAGGATCAGGACAGG - Intergenic
1077495556 11:2885020-2885042 GCTGGAGCCAGGACCGGGACTGG + Exonic
1081758824 11:45562870-45562892 GCTGAAGGCAGAGCCAGGACTGG - Intergenic
1083428487 11:62601715-62601737 GCTGGAGCCTGGCTCTGGCCTGG - Exonic
1083883586 11:65559774-65559796 GCTCTAGGCAGAGTCAGGACAGG - Intergenic
1084007732 11:66332166-66332188 GGTGGTGGCAGACACAGGACAGG + Exonic
1084214505 11:67640079-67640101 GCTGGGGCCAGCCTCAGGTCAGG - Intergenic
1084336588 11:68461145-68461167 GCTGGAGCCAGAGCCGGGTCAGG - Intronic
1084383583 11:68828621-68828643 CCTGGATCCAGACGCAGGCCTGG - Intronic
1085296460 11:75434356-75434378 GCTGGGGCCAGAGTCTGGATGGG + Intergenic
1085743316 11:79094948-79094970 TCTGAGGCCAGACCCAGGACAGG + Intronic
1089567433 11:119379086-119379108 GCTGGAGCCTGACTCTGGGCTGG + Intronic
1089567688 11:119380687-119380709 ACTGGAGTCAGAATGAGGACTGG - Intronic
1090830328 11:130416542-130416564 GCTAGATCCAAATTCAGGACGGG - Intronic
1091130661 11:133144298-133144320 GCTGGAGCCAGGCTCTGCTCAGG - Intronic
1092161707 12:6318686-6318708 GCTGGAGCCAGGGGCAGGGCTGG - Intronic
1093208121 12:16275492-16275514 GCTGGAGACTGACTGAGAACTGG + Intronic
1096099034 12:48957615-48957637 GCTGGAGCTGGAGTCAGGGCGGG + Intergenic
1096617028 12:52839185-52839207 GCTGGAGCCAGACACAGAGCAGG + Exonic
1096842607 12:54388881-54388903 GCAGGAGGCAGGCTGAGGACTGG + Intronic
1097880417 12:64681448-64681470 GTTGGTGACAGACCCAGGACTGG + Intronic
1099443887 12:82729104-82729126 GCTGGCGCAAGGCCCAGGACTGG + Intronic
1102997660 12:117362198-117362220 TCTGGAGCCACACTCAGGCCTGG + Intronic
1104724420 12:131067028-131067050 GCTGCCGCCAGGCTCAGGATAGG + Intronic
1106079116 13:26485949-26485971 GCTTGAGCCAGACTCAGGAAAGG + Intergenic
1107168484 13:37311967-37311989 GCTGAATTCAGACTCAAGACTGG + Intergenic
1107339370 13:39389510-39389532 TCTGGAGCCAGGCTCTGCACTGG + Intronic
1108187404 13:47901872-47901894 GATGCAGCCAGCCTCAGGAATGG + Intergenic
1113478070 13:110599512-110599534 GCAGAAGCCACACACAGGACTGG + Intergenic
1113600160 13:111562950-111562972 GCTGGAGCCTGAGTGAAGACTGG - Intergenic
1113741409 13:112714553-112714575 GCTGGAGCCAGAAGCCAGACGGG - Intronic
1114003930 14:18290868-18290890 GCTGTAGCCACACCCAGAACAGG + Intergenic
1119079158 14:71675720-71675742 GCTGCAGCGAGAGGCAGGACAGG + Intronic
1119080907 14:71692708-71692730 GCTGGAGCTGGACACAGTACTGG - Intronic
1119266476 14:73265607-73265629 CCTGGAGTCCGGCTCAGGACTGG - Intronic
1120416959 14:84231666-84231688 GGTGGAGACAGAATCAGGAGAGG - Intergenic
1121503634 14:94459707-94459729 GATGGGGCCACACTCAGAACTGG + Intergenic
1121536837 14:94696903-94696925 GCAGGAGCCACACTCAGGCATGG - Intergenic
1122053689 14:99077932-99077954 GCTGGAGGCAGACAGAGGAAGGG + Intergenic
1122152821 14:99734013-99734035 CTTGGAGCCAGACACAGGAAGGG + Intergenic
1122699293 14:103576742-103576764 GCTGGAGCCAGCCTGAGGAAAGG - Intronic
1122864426 14:104597127-104597149 GCTGCAGCCAGAAACAGGAGGGG + Exonic
1122864447 14:104597193-104597215 GCTGCAGCCAGAAACAGGAGGGG + Intronic
1123156460 14:106232003-106232025 CCAGGAGCCAGACATAGGACTGG - Intergenic
1123168584 14:106349548-106349570 GCAGGAGTCCGGCTCAGGACTGG - Intergenic
1123207207 14:106725094-106725116 CTTGGAGCCAGACATAGGACTGG - Intergenic
1123212231 14:106772097-106772119 CTTGGAGCCAGACATAGGACTGG - Intergenic
1123388395 15:19843089-19843111 GCTGTAGCCACACCCAGAACAGG + Intergenic
1126671699 15:51121223-51121245 GCTGGAGACAGACTGAGGTTAGG + Intergenic
1128450700 15:67804483-67804505 GCTGCAGCCATACTCAGCTCCGG - Intronic
1128686522 15:69690333-69690355 GCAGAAACCAGACACAGGACTGG - Intergenic
1128995146 15:72289799-72289821 GCCGGGGCCAGGGTCAGGACCGG - Intronic
1129202800 15:74015024-74015046 GCTGGTGCCACACCCAGGAATGG - Intronic
1130403467 15:83578291-83578313 GCTGAAGCCAGGCTGAGGGCAGG - Intronic
1130979516 15:88803251-88803273 GCTGGACCCTGGCTCCGGACCGG - Intergenic
1132574279 16:657475-657497 GCTGGAGTCAGACCCAGGCATGG + Intronic
1132582834 16:693408-693430 GCTGTAGCCACCCTCAGGCCTGG - Exonic
1132608423 16:803106-803128 GCTGGAGTCAGCCTCGGGTCTGG + Intergenic
1132718801 16:1305977-1305999 GCTGGGGCCAGGCTCTGCACAGG - Intergenic
1132728239 16:1348060-1348082 GCCGGAGCGAGACTCCCGACTGG + Intronic
1132745091 16:1433171-1433193 GCTGGAGCCTGACGCTGGAGCGG + Intergenic
1132971924 16:2693354-2693376 GCTGTGGCCAGACTGAGGTCAGG + Intronic
1134052157 16:11144818-11144840 GCTGGGGCCAGTTTCAGGAGAGG + Intronic
1136278159 16:29191706-29191728 CCTGGACCCAGACTCGGGATGGG - Intergenic
1136343972 16:29663487-29663509 GCTGGAGGGAGCCTCAGGATGGG + Intronic
1136681083 16:31962758-31962780 TCTCCAGTCAGACTCAGGACAGG + Intergenic
1136888398 16:33949570-33949592 TCTCCAGTCAGACTCAGGACAGG - Intergenic
1138105389 16:54284943-54284965 GCTGGAGCCAGACTCAGGACCGG + Exonic
1138202905 16:55103223-55103245 GCTGTAGCCAGGCTGAGGCCAGG - Intergenic
1139653949 16:68376354-68376376 CCTGGAGACAGACTCTGGCCTGG - Intronic
1140474219 16:75230688-75230710 GCCACACCCAGACTCAGGACTGG + Intronic
1141443823 16:84045576-84045598 ACTGGAGCCAGTGTCAGGTCTGG - Intergenic
1141483066 16:84319586-84319608 GCAGGAGCCAGGATCAGGGCTGG - Intronic
1142008182 16:87700407-87700429 GCTGGAGGCAGACCCTGGCCCGG - Intronic
1142082536 16:88157746-88157768 CCTGGACCCAGACTCGGGATGGG - Intergenic
1142140834 16:88472035-88472057 GTTGGGGCCACTCTCAGGACAGG + Intronic
1142295245 16:89217525-89217547 GCTGGAGGCAGAGACAGGCCCGG - Intergenic
1203084051 16_KI270728v1_random:1168252-1168274 TCTCCAGTCAGACTCAGGACAGG + Intergenic
1142504274 17:352868-352890 GCTGGAGCCAAACCAAGGCCTGG + Intronic
1142593329 17:1017341-1017363 GCTGGGGACAGACCCAGGCCCGG - Intronic
1143270188 17:5669577-5669599 GCAGGAGTGAGAGTCAGGACTGG - Intergenic
1143428759 17:6863131-6863153 GCTGGAGCCAGAGTTAGGCATGG + Intergenic
1145034699 17:19533095-19533117 GCTGGTGCCAGGCTGAGGGCAGG + Intronic
1145813665 17:27780691-27780713 GCTGGAGCCGCACTTAGGAAAGG + Intronic
1146313384 17:31788406-31788428 GATGGAGCCAGGCACAGGCCCGG - Intergenic
1146411003 17:32584904-32584926 GCTGGTGGCAGAGTTAGGACTGG + Intronic
1147427371 17:40352267-40352289 GCTGGAGCCAGGCTGAGAAGGGG + Intronic
1147447625 17:40484401-40484423 GCTAGTGCCAGAGCCAGGACTGG + Intronic
1148906650 17:50916709-50916731 GCTGGAAACAGAGTCAGGCCTGG - Intergenic
1149429801 17:56588601-56588623 GCAGGAGCCAGACTGAGGAAGGG + Intergenic
1149991212 17:61384617-61384639 GCTGGAGCCATGCTCAGGATCGG - Intronic
1150226871 17:63529180-63529202 GCTGCAGCCAGACCCTGGAGGGG + Intronic
1150572845 17:66402933-66402955 GCAGGAGGCAGAGCCAGGACAGG - Intronic
1150791815 17:68205515-68205537 GCTGGGGCCCCACTCAGGATCGG - Intergenic
1151323668 17:73366136-73366158 GCTGGAGCCGGAAGCAGGTCCGG - Intronic
1151509137 17:74547557-74547579 GCTGGAGCCAGGCAGAGGAGTGG - Intergenic
1152314947 17:79574798-79574820 GCTGGTGCCAGAGACAGGCCAGG + Intergenic
1153488404 18:5625294-5625316 GCAAGAGCCAGAGCCAGGACTGG + Intronic
1153668561 18:7388267-7388289 GCATTAGCCAGAATCAGGACAGG - Intergenic
1154533844 18:15376947-15376969 GCTGTAGCCACACCCAGAACAGG - Intergenic
1156511175 18:37638053-37638075 GCTGGGGCCTGACCCTGGACAGG - Intergenic
1156622333 18:38867281-38867303 ACTGGGGACAGACTCAGGAGTGG - Intergenic
1157391953 18:47310320-47310342 GCTGGTGCCAGAACCAGGAGAGG - Intergenic
1157747377 18:50147678-50147700 ACTGGGGCCAGGCTCAGGAACGG - Intronic
1160454812 18:78992869-78992891 GCTGGCGCCAGACTCGGGCCGGG - Exonic
1160857983 19:1226009-1226031 GCTCGGGCCAGGCTCAGGCCAGG - Intronic
1161170991 19:2812492-2812514 GCTGGAGGCTGCCTCAGGAGGGG - Intronic
1162025084 19:7889080-7889102 CCTGGGGCCTGACCCAGGACGGG + Intronic
1162189946 19:8937043-8937065 GCTGGATTCTGCCTCAGGACTGG + Exonic
1165434768 19:35789799-35789821 GCTGTGGCCAGACCCAGGGCTGG + Intergenic
1165958246 19:39515354-39515376 GCTGGAGACGGAGTCAGGACTGG - Exonic
1166109861 19:40615117-40615139 GCTGGAGCCTGACCCGGGAGGGG - Intronic
1166765946 19:45252063-45252085 GCCGGAGCCAGAGGCAGGACTGG - Intronic
1167001264 19:46746691-46746713 GCTGGAGTGAGACTGAGGAAGGG + Exonic
1167682826 19:50935639-50935661 GCTGGATCCAGAACCAGGAGGGG - Intergenic
1167769716 19:51507534-51507556 GCTGGAGAGATATTCAGGACAGG - Intergenic
1168109571 19:54184490-54184512 GCTGGAGACAAAGTCAGGAGAGG + Intronic
925329645 2:3048630-3048652 GCTGGGGAGAGACACAGGACAGG + Intergenic
926037651 2:9647746-9647768 TCTGGAACCAGAGCCAGGACTGG - Intergenic
926161588 2:10493770-10493792 GCTGGGGCCAGGCTCATGCCGGG + Intergenic
926298009 2:11582340-11582362 GCTGGAGCCAGATTCTGGAACGG - Intronic
927090084 2:19704008-19704030 GGTGGAGGCAGACACAGGGCAGG - Intergenic
927279081 2:21287833-21287855 GCTGCAGCCAGAGACAGGGCGGG + Intergenic
927649956 2:24906527-24906549 GCTGGAGCCAGCCCAAGGAGTGG - Intronic
929961238 2:46497838-46497860 GTTGGACCCAGACACAGCACTGG - Intronic
930883567 2:56298919-56298941 GCTGGAGAGAGGCTAAGGACAGG + Intronic
934614675 2:95763812-95763834 GCAGGAGCCAGACAGAGGCCAGG - Intergenic
934646230 2:96060684-96060706 GCAGGAGCCAGACAGAGGCCGGG + Intergenic
934839633 2:97616766-97616788 GCAGGAGCCAGACAGAGGCCGGG + Intergenic
936092672 2:109511263-109511285 CCTGAAGCCTGACTCGGGACTGG + Intergenic
936092914 2:109512414-109512436 CCTGGAGCTTGACTCAGGAGGGG - Intergenic
936164174 2:110105510-110105532 GTGGGAGCCAGACCAAGGACAGG + Intronic
937998856 2:127715989-127716011 GGTGGAGACAGACACAGGGCAGG + Intronic
938103340 2:128513013-128513035 AGTGGAGCCACACTCAGGGCTGG + Intergenic
938532594 2:132204238-132204260 GCTGTAGCCACACCCAGAACAGG - Intronic
942244994 2:173999502-173999524 ACTAGAGCCAGACCCAGCACTGG - Intergenic
944462006 2:199959037-199959059 TCTGGATCCACTCTCAGGACCGG - Intronic
946310158 2:218878875-218878897 GGTGGGACCAGACTCAAGACAGG - Intergenic
947637382 2:231686915-231686937 GATGGAGCCAGGCTGAGGCCAGG - Intergenic
947749042 2:232523438-232523460 GCGGGGGCCAGGCTCAGAACAGG - Exonic
948642255 2:239383200-239383222 GCTGGAGCCAGGGTCAGGGGTGG - Intronic
948880566 2:240855279-240855301 GCAGGAGTCATACTCCGGACTGG - Intergenic
1169209643 20:3758948-3758970 GCTGGTGCCAGAGCCAGGAAGGG + Intronic
1170220375 20:13935668-13935690 GCTGGGGCCAGGTTCAGGATTGG + Intronic
1171972531 20:31573171-31573193 GCTGGAGCCAGGCGCCGGCCCGG - Intronic
1172025562 20:31945935-31945957 TCTGGAGCCAGGCCCAGGAAAGG + Intronic
1172322980 20:34011546-34011568 GAAGGAGCCAGACTCAGAATAGG - Intronic
1172949859 20:38715944-38715966 GGGGGAGCCAAACTGAGGACGGG + Intergenic
1173332311 20:42085569-42085591 TCTGGAGCCGGAATCAGCACAGG + Intronic
1174993069 20:55534826-55534848 GCTGGAGGGAGACCCAGGGCTGG - Intergenic
1176142223 20:63549822-63549844 GCTGGAACCAGAGGCAGGCCTGG + Intronic
1176148995 20:63579370-63579392 CCTGGAGGCAGCCTCAGGATGGG + Intergenic
1178422144 21:32451471-32451493 GCAGGAGCCACACTCAGCCCTGG - Intronic
1179286217 21:39979430-39979452 GCTGGGGCAGGAGTCAGGACTGG + Intergenic
1180428444 22:15221671-15221693 GCTGTAGCCACACCCAGAACAGG + Intergenic
1180511052 22:16090016-16090038 GCTGTAGCCACACCCAGAACAGG + Intergenic
1181083228 22:20427488-20427510 CCTGGAGCCACCCTCAGGGCTGG - Exonic
1182008884 22:26983918-26983940 ACTGGGGCCAGAGTGAGGACAGG - Intergenic
1182040674 22:27236793-27236815 TATGGGGCCTGACTCAGGACTGG - Intergenic
1182423690 22:30260785-30260807 CCTGGACCCAGACTCTGGACAGG + Intergenic
1183007311 22:34914103-34914125 TCTGGAGCCAGCCTCTGGGCTGG + Intergenic
1183099122 22:35572760-35572782 GCTGTGGCCAGAGTCAGGCCTGG - Intergenic
1183301440 22:37060984-37061006 GCTGGAGCCAGCTGCAGAACCGG + Intronic
1184943106 22:47783021-47783043 GCTCGAGCAACACTGAGGACAGG - Intergenic
1185008567 22:48300054-48300076 GCCGGAGCCAATCTCAGGACAGG - Intergenic
1185106723 22:48875096-48875118 CTGGCAGCCAGACTCAGGACTGG + Intergenic
1185244366 22:49765382-49765404 GCGGGTGCCAGACACAGGCCTGG + Intergenic
950263902 3:11561081-11561103 GGTGCAGCCAGGCTCAGGAAGGG - Intronic
951636650 3:24786248-24786270 GCTGGAACCACATTCAGGAAGGG + Intergenic
952032226 3:29157209-29157231 GCTAGAGCCAAACTCAGAAAAGG - Intergenic
953232715 3:41078782-41078804 TCTGGAGCTAGACACAGGAAGGG + Intergenic
954582554 3:51710911-51710933 GCTGGAGCTAGAATCAGGGCTGG + Intronic
960999983 3:123367658-123367680 GCTGGAGTCAGATTCAGGGGCGG + Intronic
961210193 3:125119565-125119587 GCTGGGGCCAGAAACAAGACAGG + Intronic
961944787 3:130674423-130674445 GCTGGAGTCAGACTCTGGAAGGG - Intronic
962580247 3:136791500-136791522 TCTGGAGACAGAATAAGGACTGG - Intergenic
962772857 3:138629393-138629415 GCTGGAGCCTGGTCCAGGACAGG - Intronic
967972753 3:195011488-195011510 GCTGGAGGCACCCTCAGGAAGGG + Intergenic
968485527 4:859188-859210 GCCTGAGGCAGACGCAGGACTGG + Intronic
969057666 4:4412305-4412327 TCTGCAGCCGGACACAGGACTGG - Intronic
969058055 4:4414242-4414264 TCTGCAGCCGGACACAGGACTGG - Intronic
969175254 4:5393840-5393862 GCAAGAGGCAGACTCAGGACTGG + Intronic
969363956 4:6683094-6683116 CCTGGAGCCCAGCTCAGGACAGG - Intergenic
969588034 4:8105873-8105895 GCTGGAGGGAGACTCGGCACAGG + Intronic
972931983 4:44083035-44083057 GCTGGAACCTGACCCTGGACAGG - Intergenic
974940459 4:68461645-68461667 ACAGGAGTCAGAGTCAGGACTGG + Intronic
976161304 4:82201969-82201991 CCTTGAGCAAGACTCAGTACTGG + Intergenic
979131726 4:117055595-117055617 ATTGGAGCCAGACTGGGGACAGG + Intergenic
983961856 4:173763530-173763552 GCTGATGCCACACTCAGGCCTGG + Intergenic
984503779 4:180591417-180591439 GCAGGTGCCAGGATCAGGACTGG + Intergenic
985484151 5:139563-139585 GCTGGAGCCTGACTCCGTGCAGG - Intergenic
985619992 5:949131-949153 ACTGGAGCCGCACTCAGGCCTGG - Intergenic
985975999 5:3419589-3419611 GATGGAACAAGACTCAGGAGCGG + Intergenic
986112186 5:4730521-4730543 CCTGGAGCCAGGATCTGGACTGG - Intergenic
986403785 5:7405681-7405703 GCTAGAGCCAGACTCAGTGTAGG + Intronic
988860393 5:35271570-35271592 CCTGGAGCCAGACTCATGACTGG - Intergenic
989480572 5:41925594-41925616 GACGGAGCCAGACCCAGGCCGGG - Intronic
994052071 5:95373653-95373675 GCTGAAGCCAGAATTATGACTGG + Intergenic
997239735 5:132297453-132297475 TCTGGAGTCAGACTCAGTAGAGG + Intronic
998018448 5:138751427-138751449 CCTGCAGCCAGAAACAGGACAGG + Intronic
998202698 5:140137929-140137951 GCAGGAGGCAGTATCAGGACTGG - Intergenic
998399089 5:141838700-141838722 GCTGGAGCCTGTCTTTGGACTGG + Intergenic
999008806 5:148011883-148011905 GGTGGAGCAAGCCTCAAGACTGG - Intergenic
1001315618 5:170639292-170639314 CGTGGAGCCAGTCTCAGGGCTGG - Intronic
1002439196 5:179255624-179255646 GCTGGGGCCTGACTCAGAATGGG + Intronic
1003622085 6:7709244-7709266 GCCAGAGGCAGACTCAGGAGAGG + Intergenic
1004002418 6:11607376-11607398 GCTGGAGCCAGGCTTGAGACGGG - Intergenic
1004075884 6:12343947-12343969 TCAGGAGCCAGACTGAGGGCAGG - Intergenic
1005896581 6:30184378-30184400 TCTGTAGCCAGACTGAGGTCTGG + Intergenic
1007382979 6:41502687-41502709 GCTGGTGCCAGAGGCAGGGCTGG - Intergenic
1007829793 6:44629572-44629594 GCTGGAGCCTGAGACAGGAAGGG + Intergenic
1008034800 6:46734897-46734919 GCTGGGGGGAGAATCAGGACAGG - Intronic
1013193515 6:107824971-107824993 CCTGGAGCCAAAGTCAGGGCCGG - Intergenic
1015564236 6:134550789-134550811 CCTGGAGCCAGACCAAGGTCAGG + Intergenic
1016394722 6:143611407-143611429 TTTGGAGCCAGACTGAGGAAGGG + Intronic
1018426428 6:163687119-163687141 GCTGGTGGCAGAGCCAGGACTGG - Intergenic
1018994612 6:168701436-168701458 ACTGGGGCCAGACTCAGCACAGG + Intergenic
1019386274 7:757919-757941 GAGGGAGCCTGACACAGGACAGG - Intronic
1019709002 7:2509893-2509915 GCTGGAGACACAGCCAGGACAGG + Intergenic
1020078757 7:5275360-5275382 GCTGGAGGCAGGCCCAGGACAGG - Intronic
1025200138 7:56956825-56956847 GCTGGAGGCAGGCCCAGGACAGG + Intergenic
1025671806 7:63620107-63620129 GCTGGAGGCAGGCCCAGGACAGG - Intergenic
1026847215 7:73704964-73704986 GTTGGTGCCAGACTCTGGGCTGG - Intronic
1031997702 7:128243459-128243481 GCAGGAGCCAGGCTCATGAAAGG + Intronic
1034161971 7:149000726-149000748 GCTGGAGCGGAACTCAGAACAGG - Intergenic
1035297817 7:157877004-157877026 CCTGGTGCCACACTCAGGCCTGG - Intronic
1035704564 8:1665705-1665727 GCTGGAGCGAGACTGCGGACGGG - Intronic
1035729822 8:1846031-1846053 ACTGGATCCAGCCTCAGGGCTGG + Intronic
1036179241 8:6568741-6568763 GCGGGAGACAGTCTCAGGAGGGG - Intronic
1039880206 8:41620992-41621014 GCTGGAGGCAGGCTCAGGAGCGG - Exonic
1042352120 8:67787855-67787877 GCTGGAGCAAGAGTGAGGATGGG + Intergenic
1044926889 8:97216988-97217010 GCTGGAGCCTATCTCAGGGCTGG + Intergenic
1048388009 8:133931147-133931169 GCTGGATATAGACTCAGGAGTGG + Intergenic
1049748802 8:144274016-144274038 CCTGGATCCAGACCCAGGAAGGG + Intronic
1053314678 9:37041337-37041359 ACTGAAGCCAGACTCTGGAAAGG + Intergenic
1053685735 9:40520265-40520287 GCTGTAGCCACACCCAGAACAGG - Intergenic
1053711207 9:40810837-40810859 GCTGTAGCCACACCCAGAACAGG - Intergenic
1053791974 9:41693115-41693137 GCTGGGGCCAGAGTCAAGGCAGG - Intergenic
1053935683 9:43148567-43148589 GCTGTAGCCACACCCAGAACAGG - Intergenic
1054153179 9:61621650-61621672 GCTGGGGCCAGAGTCAAGGCAGG + Intergenic
1054180379 9:61905134-61905156 GCTGGGGCCAGAGTCAAGGCAGG - Intergenic
1054278000 9:63104708-63104730 GCTGTAGCCACACCCAGAACAGG + Intergenic
1054298815 9:63355704-63355726 GCTGTAGCCACACCCAGAACAGG - Intergenic
1054396838 9:64660226-64660248 GCTGTAGCCACACCCAGAACAGG - Intergenic
1054421116 9:64931654-64931676 GCTGTAGCCACACCCAGAACAGG - Intergenic
1054431480 9:65165430-65165452 GCTGTAGCCACACCCAGAACAGG - Intergenic
1054472974 9:65552854-65552876 GCTGGGGCCAGAGTCAAGGCAGG + Intergenic
1054498899 9:65856097-65856119 GCTGTAGCCACACCCAGAACAGG + Intergenic
1054657212 9:67676008-67676030 GCTGGGGCCAGAGTCAAGGCAGG + Intergenic
1054903327 9:70392255-70392277 TCAGGAGCCAGACACAGGTCGGG + Intronic
1057270369 9:93646982-93647004 GCTGGATCCCGGCTCAGGGCAGG - Intronic
1058946018 9:109857072-109857094 CCTGGAGGCAGTCTCAGGGCAGG - Intronic
1060722308 9:125987254-125987276 AGTGGAGTCAGACTCAGGCCTGG + Intergenic
1061014863 9:127975746-127975768 GCATGAGGCAGACACAGGACTGG + Intronic
1061222192 9:129258663-129258685 GCGGGAGCGAGACAAAGGACCGG + Intergenic
1061861510 9:133470853-133470875 GCTGGGGGCAGCCTCGGGACAGG - Intergenic
1061913903 9:133739056-133739078 GCTGCAGCCTGACTCTGGGCTGG + Intronic
1061914655 9:133743172-133743194 GCTGGACCCAGTCTCAGAAGGGG + Intergenic
1061943281 9:133894293-133894315 GCTGCAGCCAGACCCAGACCTGG + Intronic
1062014028 9:134282362-134282384 GCTGGAGGCAGCCTCAAGGCAGG - Intergenic
1062205310 9:135333233-135333255 TCTGAAGGCAGAATCAGGACTGG + Intergenic
1185736502 X:2500515-2500537 GTTGGAGCCCGACCCGGGACAGG + Intronic
1187374770 X:18742092-18742114 AAAGAAGCCAGACTCAGGACTGG - Intronic
1187434908 X:19258898-19258920 GCTGGAGTCAGTCACAGGCCTGG + Intergenic
1189268328 X:39733233-39733255 GCTGGGACCAGACTCAGAAGGGG + Intergenic
1192199322 X:69055210-69055232 GCTTGAGCCAGACACAGGGGAGG - Intergenic
1192235215 X:69291294-69291316 GCTGGGGCTGAACTCAGGACTGG - Intergenic
1197758704 X:130013532-130013554 GCTGGAGCCAGAGCCGGGACAGG - Exonic