ID: 1138105392

View in Genome Browser
Species Human (GRCh38)
Location 16:54284953-54284975
Sequence GACTCAGGACCGGTAGTGGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 65}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138105387_1138105392 1 Left 1138105387 16:54284929-54284951 CCACTGGTGGTGGCGCTGGAGCC 0: 1
1: 0
2: 1
3: 14
4: 201
Right 1138105392 16:54284953-54284975 GACTCAGGACCGGTAGTGGCCGG 0: 1
1: 0
2: 0
3: 2
4: 65
1138105385_1138105392 7 Left 1138105385 16:54284923-54284945 CCACGGCCACTGGTGGTGGCGCT 0: 1
1: 0
2: 0
3: 6
4: 123
Right 1138105392 16:54284953-54284975 GACTCAGGACCGGTAGTGGCCGG 0: 1
1: 0
2: 0
3: 2
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138105392 Original CRISPR GACTCAGGACCGGTAGTGGC CGG Exonic
910759282 1:90718822-90718844 GGCTCAGGACCCATAGCGGCTGG + Intergenic
922673433 1:227532560-227532582 GACTCAGGGCTGTTGGTGGCAGG - Intergenic
923213508 1:231828390-231828412 GACTGAGTAACAGTAGTGGCTGG + Intronic
1071573054 10:86708461-86708483 GACTCAGGACCTGTAGCTCCTGG + Intronic
1076290657 10:129343172-129343194 GACTCAAGACCAGGAGTCGCAGG - Intergenic
1080588325 11:33700491-33700513 GACCCAGGCCGGGTGGTGGCGGG + Exonic
1085167891 11:74419972-74419994 TACTCAGGACCAGTAATGCCTGG + Intergenic
1086571650 11:88291687-88291709 GACTCTGGAGCTGTAGTGCCTGG - Intergenic
1089917786 11:122175738-122175760 TACTCAGGAAAGGTAGAGGCAGG + Intergenic
1091398683 12:170001-170023 GACTCAGGGCCGACTGTGGCGGG - Intronic
1098588340 12:72182484-72182506 GACTCAGGACCAAAATTGGCTGG + Intronic
1101834315 12:108284638-108284660 TACCCAGGACAGGTAGTGGCAGG - Intergenic
1109777119 13:67055689-67055711 TACTCAGGAGCTGAAGTGGCGGG + Intronic
1113464396 13:110503692-110503714 GGCTCAGGCCCGTTAGTGTCTGG + Intronic
1114587440 14:23827202-23827224 GGCTGAGGACTGGGAGTGGCTGG - Intergenic
1124023857 15:25946549-25946571 GGCTCAGGACAGGAAGTGCCGGG + Intergenic
1125811855 15:42548731-42548753 GACCCAGGACCCGCAGTAGCCGG + Exonic
1126024541 15:44433198-44433220 TACTCAGCCCCGCTAGTGGCTGG - Intronic
1128755455 15:70180726-70180748 GCGTCAGGACGGGTAGAGGCGGG - Intergenic
1129760510 15:78126572-78126594 GACGCAGGACATGGAGTGGCTGG - Intronic
1129908280 15:79205278-79205300 GACTCAGGACAGGGAGAGGGAGG - Intergenic
1134250667 16:12571648-12571670 GACTCAGGAACGGTAGGGCTGGG + Exonic
1134434201 16:14240413-14240435 GACTCAGGATCTGCAGTTGCAGG - Exonic
1138105392 16:54284953-54284975 GACTCAGGACCGGTAGTGGCCGG + Exonic
1138506317 16:57479990-57480012 GACCCAGGAAGGGAAGTGGCAGG + Intronic
1143365603 17:6406559-6406581 GACACAGGACAGGTAGGGCCCGG - Intronic
1145890055 17:28407856-28407878 GACTCAGGATGGGTAGGTGCTGG + Intergenic
1146719483 17:35113704-35113726 GAATCAGGAGTGGTAGAGGCTGG - Intronic
1152262917 17:79276901-79276923 GACTCAGGGCTGGTACAGGCTGG + Intronic
1152619415 17:81354538-81354560 GACTCAGGACCAGGAGGCGCTGG + Intergenic
1157519387 18:48334894-48334916 GACTTGGGACCTGGAGTGGCTGG + Intronic
1158454604 18:57595041-57595063 GGCTCAGGACTGGCAGTCGCAGG + Intergenic
1160457109 18:79009108-79009130 GACACAGGCCAGGGAGTGGCGGG - Intergenic
1161768429 19:6219063-6219085 GACTCAGGACCTTGAGTGCCTGG + Intronic
931251054 2:60530821-60530843 GACTCAGGAGGGGTAGTGGGAGG - Intronic
934555023 2:95282516-95282538 GACTGAGGACAGGCATTGGCTGG + Intronic
944518073 2:200532202-200532224 GACTCAAGGCAGGTAGTGGTGGG + Intronic
1175069031 20:56316334-56316356 GACTCAGGACTGTTGGGGGCAGG + Intergenic
1177253397 21:18626575-18626597 CACTGAGGGCCTGTAGTGGCAGG + Intergenic
1178765957 21:35451042-35451064 GCCTCTGGACCTGTAGTGGGAGG + Intronic
1180962749 22:19769622-19769644 TCCACAGGAACGGTAGTGGCTGG - Intronic
1183313124 22:37122300-37122322 GACGCAGGTCGGGTAGTGGAGGG - Intergenic
1183499582 22:38170474-38170496 GACTCAGGAGCAGCAGTGTCTGG + Intronic
1184878360 22:47289582-47289604 GGCTCAGGACTGGCAGAGGCTGG + Intergenic
1185277263 22:49955177-49955199 GACTCAGGAGAGGTGGTGGTGGG - Intergenic
1185380786 22:50506707-50506729 GACTCAGGTAAGGTAGAGGCAGG + Intronic
952744208 3:36762631-36762653 GACTCAGAACAGGGAGTGCCTGG - Intergenic
953027239 3:39152372-39152394 GGCTCAGCACCGGGAGTGGAGGG + Intronic
953060670 3:39426476-39426498 GACACAGGACTGGGACTGGCAGG + Intergenic
956675829 3:71731052-71731074 GAGTGAGGACTGGGAGTGGCTGG - Intronic
966736407 3:183190388-183190410 GACTGAAGACCGTTAGTAGCAGG - Intronic
980310760 4:131126312-131126334 GACTCTGGGCCTGTGGTGGCAGG + Intergenic
985543903 5:499825-499847 GACCCTGGACTGGGAGTGGCTGG - Intronic
985801291 5:2006772-2006794 TACGCAGGACCGGTGGTGACCGG - Intergenic
986178961 5:5375952-5375974 GACACAGAACTGGTAGTGGAGGG + Intergenic
999721081 5:154399785-154399807 GACTCAGGGCCAGTGTTGGCAGG - Intronic
1006277884 6:33020741-33020763 AACTCAGGACCAGTGGTGGAAGG - Intergenic
1011798600 6:90983779-90983801 GTCACAGGACCGGGAGTGCCTGG - Intergenic
1017524939 6:155234381-155234403 GCCTCAGCATCGTTAGTGGCTGG + Intronic
1020805140 7:12780468-12780490 GAAGCAGGACCCATAGTGGCAGG + Intergenic
1035735864 8:1887295-1887317 GACTCAGGACCAGAAGAGTCAGG + Intronic
1036136506 8:6166611-6166633 GACACAGGACCTGCAGTGACTGG + Intergenic
1038975067 8:32686474-32686496 GAGACAGGGCCGGTAGTGACAGG + Intronic
1040761357 8:50849327-50849349 GACTGAGGAGCAGTAGTGCCGGG - Intergenic
1046925409 8:119781599-119781621 GACTCAGGACGGGGAGGGGGAGG + Intronic
1049531370 8:143157184-143157206 AACTCAGGGCCAGGAGTGGCCGG + Intergenic
1059824286 9:118009721-118009743 AACTCAGGAATGGTAGTGGAGGG - Intergenic
1200150939 X:153951150-153951172 GACTGTGGCCCGGTACTGGCGGG + Intronic