ID: 1138105868

View in Genome Browser
Species Human (GRCh38)
Location 16:54286928-54286950
Sequence CCCCGCGCGCGGGATCCGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 111}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138105868_1138105884 -3 Left 1138105868 16:54286928-54286950 CCCCGCGGATCCCGCGCGCGGGG 0: 1
1: 0
2: 1
3: 8
4: 111
Right 1138105884 16:54286948-54286970 GGGCGGGGCGGGGCAGGGGCGGG 0: 2
1: 40
2: 245
3: 1380
4: 6014
1138105868_1138105880 -9 Left 1138105868 16:54286928-54286950 CCCCGCGGATCCCGCGCGCGGGG 0: 1
1: 0
2: 1
3: 8
4: 111
Right 1138105880 16:54286942-54286964 CGCGCGGGGCGGGGCGGGGCAGG 0: 9
1: 50
2: 353
3: 847
4: 2952
1138105868_1138105882 -7 Left 1138105868 16:54286928-54286950 CCCCGCGGATCCCGCGCGCGGGG 0: 1
1: 0
2: 1
3: 8
4: 111
Right 1138105882 16:54286944-54286966 CGCGGGGCGGGGCGGGGCAGGGG 0: 1
1: 16
2: 89
3: 480
4: 2068
1138105868_1138105885 3 Left 1138105868 16:54286928-54286950 CCCCGCGGATCCCGCGCGCGGGG 0: 1
1: 0
2: 1
3: 8
4: 111
Right 1138105885 16:54286954-54286976 GGCGGGGCAGGGGCGGGAGCCGG 0: 1
1: 2
2: 91
3: 490
4: 3262
1138105868_1138105883 -4 Left 1138105868 16:54286928-54286950 CCCCGCGGATCCCGCGCGCGGGG 0: 1
1: 0
2: 1
3: 8
4: 111
Right 1138105883 16:54286947-54286969 GGGGCGGGGCGGGGCAGGGGCGG 0: 4
1: 55
2: 443
3: 1606
4: 7450
1138105868_1138105881 -8 Left 1138105868 16:54286928-54286950 CCCCGCGGATCCCGCGCGCGGGG 0: 1
1: 0
2: 1
3: 8
4: 111
Right 1138105881 16:54286943-54286965 GCGCGGGGCGGGGCGGGGCAGGG 0: 1
1: 28
2: 305
3: 803
4: 3000

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138105868 Original CRISPR CCCCGCGCGCGGGATCCGCG GGG (reversed) Intergenic
900786778 1:4654690-4654712 CCCCGCGCGCCTCCTCCGCGCGG + Intergenic
901641232 1:10694177-10694199 CCCTGGCCGGGGGATCCGCGAGG + Intronic
903193568 1:21669431-21669453 CCGCGGGCGCGGGAGCGGCGGGG + Intergenic
904045191 1:27604294-27604316 CCCCAGGCGCGGGGTCCCCGGGG - Intronic
904746128 1:32712348-32712370 CCCGGGGCGCGGGGTCGGCGTGG - Intergenic
904784169 1:32973134-32973156 CCTCGCGTGCCGCATCCGCGCGG + Intergenic
905308641 1:37034956-37034978 CCCGCCGCGTGGGAGCCGCGAGG - Intergenic
905803658 1:40861471-40861493 CCCCGCGCGCGCCCTCCGCGAGG - Exonic
908523392 1:64966125-64966147 CGCCGCCCGCCGGCTCCGCGGGG + Intronic
913250780 1:116910446-116910468 CCCCGCGCGCGGGGCCCGAGCGG - Intronic
913250783 1:116910455-116910477 CCCCGCGCGCGGGGTGCAAGTGG + Intronic
917359476 1:174159881-174159903 CCCCGCCCGCCCTATCCGCGAGG - Intronic
917920038 1:179743497-179743519 CGCCGGGCTCGGGCTCCGCGCGG + Intronic
919403233 1:197146369-197146391 CCCCGCGGGCGGCCTCCGCTCGG + Exonic
919639557 1:200035438-200035460 CCCCGCGCGCTTGACCCGTGCGG - Intronic
920805684 1:209231763-209231785 CCGAGCGCGCGGGGTCCGGGAGG - Intergenic
921029733 1:211326861-211326883 CTCGGCGCGCGGGCTCCGCGAGG - Exonic
922250638 1:223845996-223846018 CGCCGCGGGCGGGGTCGGCGCGG - Intergenic
923744416 1:236686847-236686869 CCACGCGCACGGGAGCCCCGCGG - Intronic
1063994986 10:11611213-11611235 CCCGGAGCGTGGGGTCCGCGGGG - Intronic
1070923875 10:80205456-80205478 TCCCGCTCGCGGGGCCCGCGGGG + Exonic
1072021821 10:91410239-91410261 CCCCGCGCGCGCCAGCCCCGCGG - Intergenic
1072420943 10:95290474-95290496 CCCAGCGCGCGGGATCTGCGGGG + Intronic
1075031864 10:119029526-119029548 CGCGGGGCGCGGGAGCCGCGCGG + Intergenic
1076734638 10:132453188-132453210 CCCCGCGCACGGGACTCGCGGGG - Intergenic
1078057347 11:8019088-8019110 CCCCTCGCTCGGGTCCCGCGGGG - Intergenic
1080503633 11:32892737-32892759 CCCCGCGAGCGGCAAGCGCGGGG + Intergenic
1083572867 11:63769286-63769308 CCCCTCCCGCGGGAGCCGCCCGG + Intergenic
1083800060 11:65041421-65041443 CCGCGCGCTGCGGATCCGCGCGG - Exonic
1083933349 11:65857836-65857858 CCCCGCGGCCGGTGTCCGCGCGG + Intronic
1084024672 11:66440716-66440738 GCCCGGGTGCGGGATCCGCTGGG - Intronic
1085266565 11:75241054-75241076 CCCCGCGCGCGGGACAGCCGGGG + Exonic
1091718534 12:2795886-2795908 CCCCGCGCCCGGCCTCCCCGGGG - Intronic
1092246655 12:6867767-6867789 CCCCGAGGCCGGTATCCGCGCGG + Intronic
1092294874 12:7189815-7189837 CCCCGCCCCTGGGACCCGCGAGG - Intronic
1094829850 12:34295098-34295120 ACCCCTGCGTGGGATCCGCGGGG - Intergenic
1094830165 12:34296491-34296513 GCCCTTGCACGGGATCCGCGGGG + Intergenic
1103899319 12:124295261-124295283 CCCCGCGCCCCGGATCCCCGCGG - Intronic
1105472093 13:20703792-20703814 CGCCGCCCGCGGGGTCCCCGGGG - Intronic
1105725544 13:23159720-23159742 CCCCGCGCGCTGGATCGCGGGGG + Intergenic
1113874347 13:113585037-113585059 CCGAGCGCGCGGGGTCCCCGAGG - Intronic
1122130841 14:99604010-99604032 CCCCGCGCCGGGGCTCCGCTGGG + Exonic
1122779237 14:104136656-104136678 CCCCGGCCGCGCGAGCCGCGCGG - Intergenic
1123055431 14:105567050-105567072 CCCTGAGCGCGGGCTCTGCGGGG + Intergenic
1126109421 15:45166963-45166985 GCCGGCGCGCGGCTTCCGCGTGG + Intergenic
1131215197 15:90530240-90530262 GGCCGCGGGCGGGACCCGCGCGG + Intronic
1132055865 15:98649778-98649800 CCCCGGGCTCGGGAGCGGCGGGG + Intronic
1133933666 16:10252175-10252197 CCCCACGCGTGGGCTCCGCCTGG - Intergenic
1136365269 16:29806627-29806649 CCCCGAGCCCGGGCCCCGCGCGG + Exonic
1138105868 16:54286928-54286950 CCCCGCGCGCGGGATCCGCGGGG - Intergenic
1142130729 16:88430482-88430504 CCCGGGGCGCGGGGTCTGCGCGG - Exonic
1142338956 16:89508382-89508404 CCGCGCCTGCGTGATCCGCGGGG - Exonic
1142727922 17:1830021-1830043 CGCAGCGCGCGGGACCCGGGTGG + Exonic
1146720421 17:35119788-35119810 CCGCCCGCCCGGGATCCGCCGGG + Exonic
1146787354 17:35731781-35731803 CCCCGGGCGGGGGAGCCGGGGGG + Exonic
1147150352 17:38510508-38510530 CCCCGCGCCCCGGAGCCGCCCGG + Exonic
1152586395 17:81191365-81191387 CCCCGCGGGCCGGCTCCGGGTGG - Intronic
1160256080 18:77250003-77250025 CTGGGCGCGCGGGATGCGCGGGG + Intergenic
1160542588 18:79632987-79633009 CCACGGGCGAGGGATCCTCGTGG - Intergenic
1160594535 18:79964672-79964694 CACCTCGCGCCGGGTCCGCGCGG + Exonic
1160719063 19:589748-589770 CCCCGCGCGCCGCCTCCGCTCGG - Intergenic
1161069091 19:2251586-2251608 TGGCGCGGGCGGGATCCGCGCGG + Exonic
1162007317 19:7788781-7788803 CCCCGAGCCTGGGAGCCGCGGGG - Intergenic
1162571986 19:11479575-11479597 CCCCGCCCCCGGGATACGCCCGG + Intronic
1166218517 19:41351662-41351684 CCCCGCGCGTGGCACCCACGTGG + Intronic
1168641411 19:58034142-58034164 CACCGCGCGCGGGCTTCGCTCGG - Exonic
1168689689 19:58369055-58369077 CCCCTCGTGCGGGAGCCGTGCGG - Exonic
925984806 2:9206955-9206977 CGCCGGGCGCGGGAGCCGCGCGG - Exonic
932495628 2:72144547-72144569 CCCCGCGCTCGGGAGCCTCTCGG + Intronic
934479459 2:94622138-94622160 GCCCCAGCGCGGGATCCGCTAGG - Intergenic
946235712 2:218323355-218323377 CGCCGCGCTCGGCAGCCGCGGGG - Intronic
946702118 2:222424501-222424523 CCCGGAGTGCGGGATCGGCGGGG + Exonic
1168830050 20:841029-841051 CCTGGCGCGCGGGGTCCCCGTGG - Intronic
1175215905 20:57391607-57391629 CCCCGAGCGCGGGCTTCCCGCGG + Exonic
1179626921 21:42654029-42654051 CCCCACGCGCCGGCTCCCCGGGG + Intronic
1181270799 22:21657553-21657575 CCCCGCCCCCGGCTTCCGCGCGG + Intronic
1184733163 22:46381992-46382014 CCCCGGGCGCGTGGTCTGCGGGG + Exonic
1185349547 22:50327289-50327311 CCCGGCTCGCGGGAGCCTCGGGG + Intergenic
1203260592 22_KI270733v1_random:169969-169991 CCGCGCTCGCGGGGTCCCCGTGG + Intergenic
951881429 3:27484283-27484305 CGCCGGGCGCGGGAGACGCGGGG + Intronic
959359082 3:105367321-105367343 GCCAGCGCGCGGGCACCGCGGGG + Exonic
960120851 3:113947829-113947851 CCTCGCCCGCGGGCACCGCGGGG + Intergenic
961820698 3:129574335-129574357 CCCCGCCCCCGAGATCCACGCGG - Exonic
964771144 3:160225528-160225550 CGGCGCGCGCGGGACCCGAGCGG + Intergenic
966743572 3:183254601-183254623 GCCCGTGCGCGGGAGCCGCGAGG + Intronic
967055567 3:185825897-185825919 CCCCGCGAGCACGGTCCGCGAGG - Intergenic
968047846 3:195634128-195634150 CCCCGCGCTCTGCATCAGCGCGG - Intergenic
968306767 3:197655795-197655817 CCCCGCGCTCTGCATCAGCGCGG + Intergenic
968701468 4:2059955-2059977 AGCCGGGCGCGGGGTCCGCGTGG - Intronic
972396836 4:38664715-38664737 CCCCGCACCCGGGGTCCGCACGG - Intronic
979205599 4:118033747-118033769 CTCCGCGCCCGGGATCTGCGCGG - Intronic
981475295 4:145180842-145180864 CCCGGCGCGCGCGATTCCCGCGG - Intergenic
985743750 5:1634947-1634969 CCCCGCGCTCTGCATCAGCGCGG + Intergenic
986747969 5:10760930-10760952 CGCCGGGCGGGGGCTCCGCGGGG - Intronic
988564928 5:32313025-32313047 GCCCGCGCACGGGATGGGCGGGG - Intergenic
990210721 5:53479972-53479994 GCCTGGGCGCGGGACCCGCGAGG - Intergenic
992269926 5:75053532-75053554 CCCCGAACGCGGGGTCCGTGCGG + Intergenic
997297464 5:132777065-132777087 CGGCGCGCGCGGGAGGCGCGGGG - Intronic
999252321 5:150190217-150190239 GCCGGTGCGCGGGAGCCGCGGGG + Exonic
1001556510 5:172641062-172641084 GCCCGGGCGCGGGAGCGGCGAGG + Intergenic
1002308150 5:178296482-178296504 GCCCCTGCGTGGGATCCGCGGGG - Intronic
1003624047 6:7726914-7726936 CACGCCTCGCGGGATCCGCGGGG + Exonic
1003624257 6:7727709-7727731 CCCGGCGCGCGGGTCCCGCCTGG + Intronic
1009402618 6:63274919-63274941 CCCCTGGTGCGGGATCCGCTGGG - Intergenic
1013803248 6:113970655-113970677 TCCCGCCCGCAGGAACCGCGGGG + Intronic
1022018437 7:26376185-26376207 CGCAGCGCGGGGGATGCGCGCGG - Intergenic
1032091869 7:128915260-128915282 CCCCTCCCGCTGGCTCCGCGGGG + Intergenic
1037886833 8:22599856-22599878 CTCCGCCCGCGGGGTGCGCGGGG - Intronic
1040423408 8:47260962-47260984 CCCCGAGCGCGGCTGCCGCGGGG - Exonic
1042253080 8:66775451-66775473 CCCCGCGCTCGTGATGGGCGCGG - Intronic
1043954239 8:86342744-86342766 CTCCGCGTGCGGGTTCCGAGTGG + Exonic
1044821815 8:96160433-96160455 CCCCGGGCGCAGGAGCCGCCAGG - Exonic
1049762449 8:144337383-144337405 CCTGGGGCGCGGGATCTGCGGGG + Intergenic
1053928353 9:43089786-43089808 GCCCCAGCGCGGGATCCGCTAGG + Intergenic
1057758303 9:97853874-97853896 CCCCGGGCTCTGGATCCCCGCGG - Exonic
1057883071 9:98807853-98807875 CCCGGGGCGCGGGGTGCGCGGGG - Exonic
1061129839 9:128702720-128702742 TCCCGGGCGCTGGATCGGCGCGG + Exonic
1061170178 9:128947903-128947925 CCCCGCGCGCGGGGACCGTTTGG - Intronic
1061517190 9:131096717-131096739 CACCGCGCGCGGGAAGCGGGCGG + Intronic
1189002832 X:36963840-36963862 CCGAGCGCGCGGGGTCCCCGAGG + Intergenic
1198005503 X:132489421-132489443 CCCCACGCCCGGCCTCCGCGAGG - Intronic