ID: 1138105953

View in Genome Browser
Species Human (GRCh38)
Location 16:54287186-54287208
Sequence CTAAGCTGCTGAAAGTGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138105953_1138105965 7 Left 1138105953 16:54287186-54287208 CCCGGCCACTTTCAGCAGCTTAG No data
Right 1138105965 16:54287216-54287238 GCTAGCAGCCGGCGTGGGGGTGG No data
1138105953_1138105966 8 Left 1138105953 16:54287186-54287208 CCCGGCCACTTTCAGCAGCTTAG No data
Right 1138105966 16:54287217-54287239 CTAGCAGCCGGCGTGGGGGTGGG No data
1138105953_1138105960 -4 Left 1138105953 16:54287186-54287208 CCCGGCCACTTTCAGCAGCTTAG No data
Right 1138105960 16:54287205-54287227 TTAGGGAGGGAGCTAGCAGCCGG No data
1138105953_1138105970 17 Left 1138105953 16:54287186-54287208 CCCGGCCACTTTCAGCAGCTTAG No data
Right 1138105970 16:54287226-54287248 GGCGTGGGGGTGGGGAGCGAGGG No data
1138105953_1138105963 3 Left 1138105953 16:54287186-54287208 CCCGGCCACTTTCAGCAGCTTAG No data
Right 1138105963 16:54287212-54287234 GGGAGCTAGCAGCCGGCGTGGGG No data
1138105953_1138105962 2 Left 1138105953 16:54287186-54287208 CCCGGCCACTTTCAGCAGCTTAG No data
Right 1138105962 16:54287211-54287233 AGGGAGCTAGCAGCCGGCGTGGG No data
1138105953_1138105967 9 Left 1138105953 16:54287186-54287208 CCCGGCCACTTTCAGCAGCTTAG No data
Right 1138105967 16:54287218-54287240 TAGCAGCCGGCGTGGGGGTGGGG No data
1138105953_1138105961 1 Left 1138105953 16:54287186-54287208 CCCGGCCACTTTCAGCAGCTTAG No data
Right 1138105961 16:54287210-54287232 GAGGGAGCTAGCAGCCGGCGTGG No data
1138105953_1138105964 4 Left 1138105953 16:54287186-54287208 CCCGGCCACTTTCAGCAGCTTAG No data
Right 1138105964 16:54287213-54287235 GGAGCTAGCAGCCGGCGTGGGGG No data
1138105953_1138105969 16 Left 1138105953 16:54287186-54287208 CCCGGCCACTTTCAGCAGCTTAG No data
Right 1138105969 16:54287225-54287247 CGGCGTGGGGGTGGGGAGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138105953 Original CRISPR CTAAGCTGCTGAAAGTGGCC GGG (reversed) Intergenic
No off target data available for this crispr