ID: 1138106001

View in Genome Browser
Species Human (GRCh38)
Location 16:54287367-54287389
Sequence TGCGAATCCCTTACTAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138105997_1138106001 -10 Left 1138105997 16:54287354-54287376 CCCCGGGTCCGTGTGCGAATCCC No data
Right 1138106001 16:54287367-54287389 TGCGAATCCCTTACTAAAAATGG No data
1138105991_1138106001 15 Left 1138105991 16:54287329-54287351 CCAGAGATTAGCCACTTAACGCC No data
Right 1138106001 16:54287367-54287389 TGCGAATCCCTTACTAAAAATGG No data
1138105989_1138106001 21 Left 1138105989 16:54287323-54287345 CCAAACCCAGAGATTAGCCACTT No data
Right 1138106001 16:54287367-54287389 TGCGAATCCCTTACTAAAAATGG No data
1138105995_1138106001 -6 Left 1138105995 16:54287350-54287372 CCGCCCCCGGGTCCGTGTGCGAA No data
Right 1138106001 16:54287367-54287389 TGCGAATCCCTTACTAAAAATGG No data
1138105994_1138106001 4 Left 1138105994 16:54287340-54287362 CCACTTAACGCCGCCCCCGGGTC No data
Right 1138106001 16:54287367-54287389 TGCGAATCCCTTACTAAAAATGG No data
1138105996_1138106001 -9 Left 1138105996 16:54287353-54287375 CCCCCGGGTCCGTGTGCGAATCC No data
Right 1138106001 16:54287367-54287389 TGCGAATCCCTTACTAAAAATGG No data
1138105988_1138106001 30 Left 1138105988 16:54287314-54287336 CCAGCAGGACCAAACCCAGAGAT No data
Right 1138106001 16:54287367-54287389 TGCGAATCCCTTACTAAAAATGG No data
1138105990_1138106001 16 Left 1138105990 16:54287328-54287350 CCCAGAGATTAGCCACTTAACGC No data
Right 1138106001 16:54287367-54287389 TGCGAATCCCTTACTAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138106001 Original CRISPR TGCGAATCCCTTACTAAAAA TGG Intergenic
No off target data available for this crispr