ID: 1138107590

View in Genome Browser
Species Human (GRCh38)
Location 16:54297539-54297561
Sequence AAATATCAGCAGAAGTAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138107590_1138107594 20 Left 1138107590 16:54297539-54297561 CCATGCTACTTCTGCTGATATTT No data
Right 1138107594 16:54297582-54297604 TAACCATGCTTAAAGTCAAGAGG No data
1138107590_1138107598 26 Left 1138107590 16:54297539-54297561 CCATGCTACTTCTGCTGATATTT No data
Right 1138107598 16:54297588-54297610 TGCTTAAAGTCAAGAGGGCAGGG No data
1138107590_1138107595 21 Left 1138107590 16:54297539-54297561 CCATGCTACTTCTGCTGATATTT No data
Right 1138107595 16:54297583-54297605 AACCATGCTTAAAGTCAAGAGGG No data
1138107590_1138107597 25 Left 1138107590 16:54297539-54297561 CCATGCTACTTCTGCTGATATTT No data
Right 1138107597 16:54297587-54297609 ATGCTTAAAGTCAAGAGGGCAGG No data
1138107590_1138107592 -10 Left 1138107590 16:54297539-54297561 CCATGCTACTTCTGCTGATATTT No data
Right 1138107592 16:54297552-54297574 GCTGATATTTCATTGGCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138107590 Original CRISPR AAATATCAGCAGAAGTAGCA TGG (reversed) Intergenic
No off target data available for this crispr