ID: 1138109276

View in Genome Browser
Species Human (GRCh38)
Location 16:54310742-54310764
Sequence TGACAGCTGCACAATGTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138109275_1138109276 -6 Left 1138109275 16:54310725-54310747 CCGGAGATAGATGGTGGTGACAG No data
Right 1138109276 16:54310742-54310764 TGACAGCTGCACAATGTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138109276 Original CRISPR TGACAGCTGCACAATGTGAA TGG Intergenic
No off target data available for this crispr