ID: 1138109766

View in Genome Browser
Species Human (GRCh38)
Location 16:54314318-54314340
Sequence AGGAAAGAGAGAGGGAGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138109766_1138109771 -5 Left 1138109766 16:54314318-54314340 CCCCTGCTCCCTCTCTCTTTCCT No data
Right 1138109771 16:54314336-54314358 TTCCTGCTACCTTGTGAAGAAGG No data
1138109766_1138109774 20 Left 1138109766 16:54314318-54314340 CCCCTGCTCCCTCTCTCTTTCCT No data
Right 1138109774 16:54314361-54314383 CTTGCTTCTCCTTCACCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138109766 Original CRISPR AGGAAAGAGAGAGGGAGCAG GGG (reversed) Intergenic
No off target data available for this crispr