ID: 1138109769

View in Genome Browser
Species Human (GRCh38)
Location 16:54314326-54314348
Sequence AAGGTAGCAGGAAAGAGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138109769_1138109774 12 Left 1138109769 16:54314326-54314348 CCCTCTCTCTTTCCTGCTACCTT No data
Right 1138109774 16:54314361-54314383 CTTGCTTCTCCTTCACCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138109769 Original CRISPR AAGGTAGCAGGAAAGAGAGA GGG (reversed) Intergenic
No off target data available for this crispr