ID: 1138109771

View in Genome Browser
Species Human (GRCh38)
Location 16:54314336-54314358
Sequence TTCCTGCTACCTTGTGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138109768_1138109771 -7 Left 1138109768 16:54314320-54314342 CCTGCTCCCTCTCTCTTTCCTGC No data
Right 1138109771 16:54314336-54314358 TTCCTGCTACCTTGTGAAGAAGG No data
1138109767_1138109771 -6 Left 1138109767 16:54314319-54314341 CCCTGCTCCCTCTCTCTTTCCTG No data
Right 1138109771 16:54314336-54314358 TTCCTGCTACCTTGTGAAGAAGG No data
1138109766_1138109771 -5 Left 1138109766 16:54314318-54314340 CCCCTGCTCCCTCTCTCTTTCCT No data
Right 1138109771 16:54314336-54314358 TTCCTGCTACCTTGTGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138109771 Original CRISPR TTCCTGCTACCTTGTGAAGA AGG Intergenic
No off target data available for this crispr