ID: 1138109772

View in Genome Browser
Species Human (GRCh38)
Location 16:54314338-54314360
Sequence TGCCTTCTTCACAAGGTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138109772_1138109777 22 Left 1138109772 16:54314338-54314360 CCTGCTACCTTGTGAAGAAGGCA No data
Right 1138109777 16:54314383-54314405 GCATGATTGTAAGTTTCCTGAGG 0: 64
1: 6181
2: 8450
3: 6746
4: 4304
1138109772_1138109774 0 Left 1138109772 16:54314338-54314360 CCTGCTACCTTGTGAAGAAGGCA No data
Right 1138109774 16:54314361-54314383 CTTGCTTCTCCTTCACCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138109772 Original CRISPR TGCCTTCTTCACAAGGTAGC AGG (reversed) Intergenic
No off target data available for this crispr